ID: 911372909

View in Genome Browser
Species Human (GRCh38)
Location 1:97015420-97015442
Sequence GGTAGCAAAGCCTTTGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911372909_911372913 14 Left 911372909 1:97015420-97015442 CCTGCTACAAAGGCTTTGCTACC No data
Right 911372913 1:97015457-97015479 GCTGTGTTTACTCACCATGGTGG No data
911372909_911372912 11 Left 911372909 1:97015420-97015442 CCTGCTACAAAGGCTTTGCTACC No data
Right 911372912 1:97015454-97015476 ATTGCTGTGTTTACTCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911372909 Original CRISPR GGTAGCAAAGCCTTTGTAGC AGG (reversed) Intergenic
No off target data available for this crispr