ID: 911372913

View in Genome Browser
Species Human (GRCh38)
Location 1:97015457-97015479
Sequence GCTGTGTTTACTCACCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911372910_911372913 -7 Left 911372910 1:97015441-97015463 CCATATACCTCTCATTGCTGTGT No data
Right 911372913 1:97015457-97015479 GCTGTGTTTACTCACCATGGTGG No data
911372908_911372913 19 Left 911372908 1:97015415-97015437 CCAATCCTGCTACAAAGGCTTTG No data
Right 911372913 1:97015457-97015479 GCTGTGTTTACTCACCATGGTGG No data
911372909_911372913 14 Left 911372909 1:97015420-97015442 CCTGCTACAAAGGCTTTGCTACC No data
Right 911372913 1:97015457-97015479 GCTGTGTTTACTCACCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911372913 Original CRISPR GCTGTGTTTACTCACCATGG TGG Intergenic
No off target data available for this crispr