ID: 911375621

View in Genome Browser
Species Human (GRCh38)
Location 1:97047169-97047191
Sequence AGTTATGGATGTTCATAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911375614_911375621 28 Left 911375614 1:97047118-97047140 CCAGCTCTGACATAGGAGGGGAA No data
Right 911375621 1:97047169-97047191 AGTTATGGATGTTCATAGAAGGG No data
911375617_911375621 0 Left 911375617 1:97047146-97047168 CCCGAGAGGTGCAAAGTATTCTA No data
Right 911375621 1:97047169-97047191 AGTTATGGATGTTCATAGAAGGG No data
911375616_911375621 1 Left 911375616 1:97047145-97047167 CCCCGAGAGGTGCAAAGTATTCT No data
Right 911375621 1:97047169-97047191 AGTTATGGATGTTCATAGAAGGG No data
911375618_911375621 -1 Left 911375618 1:97047147-97047169 CCGAGAGGTGCAAAGTATTCTAA No data
Right 911375621 1:97047169-97047191 AGTTATGGATGTTCATAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911375621 Original CRISPR AGTTATGGATGTTCATAGAA GGG Intergenic
No off target data available for this crispr