ID: 911381477

View in Genome Browser
Species Human (GRCh38)
Location 1:97120395-97120417
Sequence CAGCTTTCCTTGAAGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911381470_911381477 3 Left 911381470 1:97120369-97120391 CCTTTGCCACCCATGGGCCACCT 0: 1
1: 0
2: 2
3: 24
4: 235
Right 911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG No data
911381467_911381477 13 Left 911381467 1:97120359-97120381 CCTTTCAGCGCCTTTGCCACCCA 0: 1
1: 0
2: 0
3: 14
4: 147
Right 911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG No data
911381473_911381477 -7 Left 911381473 1:97120379-97120401 CCATGGGCCACCTAGACAGCTTT 0: 1
1: 0
2: 0
3: 13
4: 135
Right 911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG No data
911381472_911381477 -6 Left 911381472 1:97120378-97120400 CCCATGGGCCACCTAGACAGCTT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG No data
911381471_911381477 -3 Left 911381471 1:97120375-97120397 CCACCCATGGGCCACCTAGACAG 0: 1
1: 0
2: 0
3: 6
4: 102
Right 911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG No data
911381466_911381477 19 Left 911381466 1:97120353-97120375 CCATTTCCTTTCAGCGCCTTTGC 0: 1
1: 0
2: 1
3: 21
4: 241
Right 911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911381477 Original CRISPR CAGCTTTCCTTGAAGACAAA GGG Intronic
No off target data available for this crispr