ID: 911383086

View in Genome Browser
Species Human (GRCh38)
Location 1:97140331-97140353
Sequence CTACATTGAAAGCCCTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911383086 Original CRISPR CTACATTGAAAGCCCTGCCA AGG Intronic
903509029 1:23859797-23859819 CTACAATGACAGCCCTGTCAAGG - Exonic
903665303 1:25003475-25003497 ATCCATTGAAGGCCCTGCCTGGG - Intergenic
904359012 1:29960380-29960402 CCACCCTGAATGCCCTGCCAGGG - Intergenic
909433039 1:75611976-75611998 TTGCATTGAAAGGCTTGCCAGGG + Intergenic
911138330 1:94467406-94467428 CTAAATTGAAAGCCCTATGAGGG + Intronic
911383086 1:97140331-97140353 CTACATTGAAAGCCCTGCCAAGG + Intronic
916040220 1:160955058-160955080 CTACATTGTATGGCCTGCCTTGG - Intergenic
918564887 1:185917712-185917734 CTACATTGAAAGTCCCTTCAAGG - Intronic
1065329965 10:24585597-24585619 CTTCATGGAAAACCTTGCCAGGG + Exonic
1067551979 10:47242677-47242699 ACACATGCAAAGCCCTGCCATGG + Intergenic
1069034469 10:63632142-63632164 TTAGACTGAAAGCCCTGCCAGGG - Intergenic
1070838589 10:79467731-79467753 CTGCCTTGAAAGTCCTGCCCTGG - Intergenic
1071496294 10:86169761-86169783 CTAGAGGCAAAGCCCTGCCATGG + Intronic
1076449781 10:130548959-130548981 CGTCATGGAAAGCCCTGCCCAGG + Intergenic
1077200012 11:1302062-1302084 CTGCCTTGAAGGCCCTGCAAGGG + Intronic
1081210477 11:40327233-40327255 CTCTGTTGAAAGCCCTGTCATGG - Intronic
1081330045 11:41791096-41791118 CTCCATTGCATGCCCTGCAAGGG + Intergenic
1083502858 11:63127277-63127299 CTACATTCAAGTCCCTGCAAAGG + Intronic
1083962217 11:66020811-66020833 CTACATGGACAGCCGTGCCCAGG - Exonic
1085651162 11:78269845-78269867 CTACTGTGAAATTCCTGCCAAGG + Intronic
1086126600 11:83355240-83355262 CTATGTGGAAAGCCCTGGCATGG - Intergenic
1088648921 11:111940283-111940305 TTGCATTGAAAGCACTGACAAGG - Intronic
1089064490 11:115652248-115652270 CTACATGGAAGGCCCTACCCAGG - Intergenic
1091237489 11:134031823-134031845 CTTCATTGATACCCCTCCCACGG + Intergenic
1091462941 12:659514-659536 CTTCACTGGTAGCCCTGCCAGGG - Intronic
1091821142 12:3475942-3475964 CAACTTTGAAAGCTCTGACATGG - Intronic
1093156236 12:15689026-15689048 CGACATTGCATGCCCTGCGAGGG + Intronic
1100714019 12:97287129-97287151 CCACATTAAAAGACCTGCCTGGG + Intergenic
1104787997 12:131462363-131462385 TTCCATTGAAAGCTCTGCCCTGG + Intergenic
1108712728 13:53049724-53049746 CCAGATTGAAAGCCCACCCATGG + Intronic
1108990146 13:56645686-56645708 CTACATTGAAAGCCAAAGCAGGG - Intergenic
1111521354 13:89409206-89409228 CTTCATTGGAAGTCCTGTCAAGG + Intergenic
1111613173 13:90631251-90631273 TTACATTGTAAGCTCTGCAAGGG + Intergenic
1111996631 13:95172289-95172311 CTACATTAAGAGGCCAGCCACGG + Intronic
1113901408 13:113800355-113800377 CAACCTTGAAAGCCCTGGCCAGG - Intronic
1115741898 14:36397729-36397751 CTACATTAGAAGCCCTGTTATGG - Intergenic
1117902814 14:60552700-60552722 CTGTATTGAAAACCCTCCCATGG - Intergenic
1118536087 14:66766314-66766336 CTGAATTTTAAGCCCTGCCAAGG + Intronic
1119043832 14:71299414-71299436 CTGCATTGCAAGCCCTCCCCTGG - Intergenic
1119821214 14:77617334-77617356 CTGTATAGAAAACCCTGCCAAGG - Intergenic
1121373350 14:93381468-93381490 CTTCATCAAAAGCCCTGACAGGG - Intronic
1122539891 14:102492244-102492266 CTAGAGTGAGGGCCCTGCCAGGG + Intronic
1127918073 15:63471825-63471847 GGACCTTGAATGCCCTGCCAAGG + Intergenic
1128392376 15:67190927-67190949 CTACCTAGAACGCCCTTCCAAGG - Exonic
1129708003 15:77805626-77805648 CCAGTTTGGAAGCCCTGCCATGG - Intronic
1130299725 15:82670990-82671012 CTACAATGAAAGGCCAGGCACGG + Intronic
1134346549 16:13397246-13397268 CCCCATTACAAGCCCTGCCAGGG - Intergenic
1135349979 16:21720693-21720715 CTATATTAAAAGACCTGCCCAGG + Intronic
1136776151 16:32872921-32872943 CTACACCCAAAGGCCTGCCAGGG - Intergenic
1136894464 16:33988591-33988613 CTACACCCAAAGGCCTGCCAGGG + Intergenic
1203078567 16_KI270728v1_random:1135030-1135052 CTACACCCAAAGGCCTGCCAGGG - Intergenic
1143590263 17:7881767-7881789 CTACCTTCCAGGCCCTGCCACGG - Intronic
1144800377 17:17922112-17922134 CTACACTGAAAGCACTCCCCAGG + Intronic
1145928478 17:28665964-28665986 CTACATTTAAAACCCTGCAATGG + Intronic
1149884462 17:60327380-60327402 CCACATTGACAGCTGTGCCATGG - Intronic
1152083989 17:78206063-78206085 CTACCATGAAAGGGCTGCCAGGG - Intronic
1152841025 17:82568291-82568313 GTCCAGTGACAGCCCTGCCAGGG + Intronic
1156065929 18:33142328-33142350 CAACATGGAAAGCCCCTCCATGG + Intronic
1157873664 18:51252326-51252348 ATACATTGAAAACCCTACCCAGG - Intergenic
1160758317 19:769928-769950 CCACATTGACATCCCTGCCCTGG + Intergenic
1163385307 19:16996483-16996505 CTAAGTTGAGAGCCCTGCAAAGG - Intronic
1167615426 19:50530289-50530311 CTGTATTGGAAGCCCTGCCTGGG + Intronic
925048981 2:796446-796468 CTTCCTTGAAAGCTCTGCCGGGG + Intergenic
925218659 2:2120220-2120242 CTACATTCACAGCCCTGGGAGGG + Intronic
925539053 2:4946566-4946588 AGACATTCAAAGCCCTGCCCTGG + Intergenic
929367731 2:41180890-41180912 CAACATTCAATGCCCTTCCATGG + Intergenic
935718571 2:105960081-105960103 CAACCTTTAAAGCCATGCCAAGG - Intergenic
937842235 2:126535455-126535477 CTATTGTGAAAGCCCAGCCAAGG + Intergenic
937854795 2:126664453-126664475 CTACATTGAAAGCTCAGCCAGGG + Intronic
941669589 2:168278058-168278080 CACCATGGAAAGCCTTGCCATGG + Intergenic
1173798983 20:45882928-45882950 CTACTTTGCCATCCCTGCCAAGG + Exonic
1174534084 20:51237479-51237501 CTGCACTGAAAACCCTGGCAGGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1180581457 22:16842919-16842941 CTACTGGTAAAGCCCTGCCATGG - Intergenic
1181863254 22:25835511-25835533 CTGCAGGGAAAGCCCTGACAAGG + Intronic
949484913 3:4528635-4528657 CTACTATGAAAGGCCTGTCATGG - Intronic
951545990 3:23825808-23825830 CTCCATTTAAAGCTCTCCCACGG - Intronic
952352182 3:32550825-32550847 CCACATTGAAAACCATTCCATGG + Intronic
952377996 3:32782796-32782818 CAACCTTGAAGGCCCTCCCATGG - Intergenic
952551112 3:34477808-34477830 CTACAATTTAAGCACTGCCAGGG + Intergenic
955141004 3:56269961-56269983 CCACATTGGAAGCCGTTCCAAGG + Intronic
955525540 3:59816063-59816085 CTACAAAGAAAGGCCTGCCCAGG + Intronic
957597011 3:82279475-82279497 CTTCATTGATAGCCCTGCAAAGG + Intergenic
970142626 4:12998522-12998544 CTCCATGCAAAGCCCTGCTAAGG - Intergenic
974699666 4:65424320-65424342 CAAGATGGAAAGGCCTGCCATGG + Intronic
975736737 4:77388719-77388741 CTACATTGAAAACCTATCCAAGG + Intronic
977347998 4:95841714-95841736 CTACATAGAAACCCATGGCAGGG - Intergenic
991577861 5:68123274-68123296 CTACATTGAAATCCAATCCAAGG + Intergenic
993352417 5:86866656-86866678 ATAAATCGAAAGCCCTGCTAGGG - Intergenic
1001940178 5:175734690-175734712 CCACATTGCACGCCCTGCGACGG + Intergenic
1003499725 6:6694499-6694521 CTCCATCGCAAGCCCTGCCACGG - Intergenic
1004164128 6:13240783-13240805 CTACATTTAAAGACCTCTCAGGG + Intronic
1005854721 6:29852321-29852343 CTGGATTGAACGCCCTGCCCAGG - Intergenic
1008373110 6:50758990-50759012 ATTCATCAAAAGCCCTGCCATGG - Intronic
1008401706 6:51070844-51070866 CTGCATTGAAATGCCTGGCAAGG + Intergenic
1010791036 6:80065468-80065490 CTTCATGGAAAACCTTGCCAGGG + Intergenic
1012654985 6:101806113-101806135 CTCCATTGAAGGCACTGCCATGG - Intronic
1013607011 6:111759746-111759768 CTACATTGAAAGCTCCCCGACGG + Intronic
1014305915 6:119742103-119742125 CTAAATGGAAAGCACTGTCAGGG - Intergenic
1015091495 6:129364144-129364166 ATTTATTAAAAGCCCTGCCAGGG + Intronic
1019147775 6:169985931-169985953 CTACATGGAAAACCCAGCCAGGG - Intergenic
1021368604 7:19812998-19813020 CCACATTGAAAATCCTGCCACGG + Intergenic
1023031893 7:36096869-36096891 CTTCAATGAGAGCCCTGACAGGG - Intergenic
1026074773 7:67156442-67156464 GTACATTGGCAGCCCTGCCAGGG + Intronic
1026702091 7:72655720-72655742 GTACATTGGCGGCCCTGCCAGGG - Intronic
1031914897 7:127553854-127553876 CTACAGTGAAGGCTCTCCCAAGG - Intergenic
1033449952 7:141453720-141453742 GGACATTGAAAGCCCTTCGAGGG - Intronic
1033797191 7:144860240-144860262 CTACAGTGAAAGCCCACCAATGG + Intergenic
1033814491 7:145055293-145055315 CTACTTAGAAAACCCTGCCAGGG - Intergenic
1036086063 8:5614452-5614474 CCACCATGAAAGCTCTGCCAAGG - Intergenic
1041774444 8:61508944-61508966 CTCCATTGAAAGCCCTGGGATGG + Intronic
1043925171 8:86028533-86028555 CAATATTGTAAGCCCTGCAACGG + Intronic
1045640005 8:104239114-104239136 ATGCATTGTAAGCCCTGCCTTGG + Intronic
1045703841 8:104897496-104897518 CTACATTGATGTCCCTGCAAAGG - Intronic
1051986358 9:23092577-23092599 CTACATTGCCATCACTGCCAAGG - Intergenic
1053062640 9:35043983-35044005 CTACTTTGCATGCCCTTCCATGG - Exonic
1054699414 9:68397623-68397645 TTAGACTGAAAGCACTGCCACGG - Intronic
1056427277 9:86489820-86489842 CTACTTTGTAGTCCCTGCCAAGG - Intergenic
1059415912 9:114162417-114162439 GTGCATAGAAAGCCCTGCCCTGG - Intronic
1059453422 9:114385218-114385240 CTTCTTGGAAATCCCTGCCAGGG + Intronic
1059649787 9:116305318-116305340 CTTCACTGGAAGCCCTGACAGGG - Intronic
1060633766 9:125183872-125183894 CTATATTGAAAGCCCCTCAAAGG + Intronic
1061649874 9:132038871-132038893 CTCCGTTCGAAGCCCTGCCACGG - Intronic
1191075085 X:56444463-56444485 CTACATTGAAACCCAATCCAAGG - Intergenic
1195548548 X:106139844-106139866 GTACATTGAAACCCAAGCCAAGG + Intergenic
1198681456 X:139187020-139187042 CTACACTGTGAGCCCTGCAAGGG + Intronic