ID: 911385607

View in Genome Browser
Species Human (GRCh38)
Location 1:97171172-97171194
Sequence GCCAATAAACGGAAGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911385607 Original CRISPR GCCAATAAACGGAAGGTCCA TGG Intronic
911385607 1:97171172-97171194 GCCAATAAACGGAAGGTCCATGG + Intronic
914795324 1:150915367-150915389 CCAAACAAACTGAAGGTCCATGG - Intergenic
921803785 1:219431602-219431624 GTCAATAAAGGTAAGGGCCACGG - Intergenic
1079030449 11:16982441-16982463 GCCCAGAAACAGAATGTCCAGGG + Intronic
1090469837 11:126970417-126970439 GCCAATAAACAGAAGACCCTAGG + Intronic
1094370822 12:29736140-29736162 GCCAATATACAGAAAGCCCAGGG + Intronic
1100849325 12:98692777-98692799 GCCCATCAACGGAAGGTTAAAGG - Intronic
1112437104 13:99398386-99398408 GCCTATAAAAGGGAGGTCAAAGG - Intergenic
1113693890 13:112330643-112330665 GCCAAGAAACCGAAGGTCACGGG + Intergenic
1115645076 14:35363653-35363675 GCTCAGACACGGAAGGTCCAGGG + Intergenic
1116548101 14:46197324-46197346 GCCAAAAAACTAGAGGTCCAGGG - Intergenic
1120862284 14:89265712-89265734 GCTAGTAAGTGGAAGGTCCAAGG + Intronic
1121389236 14:93560115-93560137 GAAACTAAACGGAAGGTACAAGG + Intronic
1126914203 15:53447590-53447612 CCCATTAAACGGAAGCTACAGGG - Intergenic
1127635012 15:60860827-60860849 GAAAATAAAAGGAAGTTCCATGG - Intronic
1132265162 15:100463777-100463799 GCAAAGAAAAGGAAGGTACAAGG - Intronic
1145025819 17:19467127-19467149 GCCAATGAGCAGAAAGTCCAAGG + Intergenic
1146515686 17:33487438-33487460 GCTCATAAATGGAAGGGCCAGGG - Intronic
1155604948 18:27594343-27594365 GCCACGAAAGGGAAGGTGCAAGG - Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
930972673 2:57416138-57416160 GCCAATAAAGGTAAGGTGTATGG + Intergenic
933853687 2:86393170-86393192 GCCCATAAACAAAATGTCCACGG - Intergenic
941211362 2:162643980-162644002 GCCCATAAACTGAAGAACCACGG - Intronic
943319994 2:186434216-186434238 GTCAATAAATCCAAGGTCCAAGG + Intergenic
967662207 3:192126705-192126727 GCCAATAAAGGATAGGTCCCGGG - Intergenic
968560305 4:1277172-1277194 GCCATGAAAAGGAATGTCCATGG + Intergenic
970507962 4:16752040-16752062 GCGAATAAATGCATGGTCCAGGG + Intronic
970600269 4:17636579-17636601 GCCAATGAGCTGAAGGTCCTCGG + Exonic
972239962 4:37179613-37179635 GCCAAGAAATCGAAGGTCAAGGG - Intergenic
974351583 4:60754603-60754625 GCCAATAAATGGAAGGAAAAGGG - Intergenic
975510054 4:75184415-75184437 GCCAATAAAAAAAATGTCCAGGG + Intergenic
988562239 5:32291658-32291680 GCCCATAAACGAAATGGCCATGG + Intronic
991500213 5:67269196-67269218 TCCAAGAAACTGAATGTCCATGG - Intergenic
1006029000 6:31165527-31165549 GCCAAGAAAGGGAAGGTCCCCGG + Intronic
1015195776 6:130523481-130523503 CTCAATAACCGGAAAGTCCAGGG + Intergenic
1024520589 7:50302431-50302453 GGCAATAAACATAAGGTACAAGG - Intergenic
1024893396 7:54227869-54227891 GCCAATAAGGGGTATGTCCATGG - Intergenic
1024900522 7:54314518-54314540 GCCAATAAGGGGTATGTCCATGG + Intergenic
1025717997 7:63981787-63981809 GCTAATAAACGGAAATTTCATGG + Intergenic
1028002536 7:85517957-85517979 TCCATTAAACAGAAGATCCACGG + Intergenic
1033232359 7:139610474-139610496 GCAAATAAAAGGAAGCTACAAGG + Intronic
1038411358 8:27362063-27362085 GTCCATAAAAGGAAGATCCAAGG - Intronic
1045312439 8:101014751-101014773 GCCAATAAAGGGAATGCTCAGGG + Intergenic
1046796924 8:118383592-118383614 GCCAATACAGAGAAGGACCAAGG + Intronic
1050277139 9:4011622-4011644 GACTAGAGACGGAAGGTCCAGGG - Intronic
1052026177 9:23575928-23575950 GCCAAGATAGGGAAGGTCCAAGG + Intergenic
1052609894 9:30758859-30758881 GTAAATAAATGGACGGTCCATGG - Intergenic
1052767647 9:32657929-32657951 GCCAACAACCGGCAGGGCCAAGG - Intergenic
1054762887 9:69019165-69019187 GCCAATTAACAGAAGGCCCTAGG + Intergenic
1059001441 9:110352662-110352684 GCTAGTAAAGGGAAGGACCAGGG + Intergenic
1059728008 9:117028202-117028224 GTGAATAAACAGAAGGTTCAAGG + Intronic
1189047607 X:37610204-37610226 GCCAATACAGGGAAGAACCAAGG - Intronic
1190256174 X:48764213-48764235 GCCCATAAATGAAAGGTACAAGG + Intronic