ID: 911392018

View in Genome Browser
Species Human (GRCh38)
Location 1:97256947-97256969
Sequence GTGTGAAGTGGGAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 845
Summary {0: 1, 1: 0, 2: 9, 3: 61, 4: 774}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911392018_911392027 29 Left 911392018 1:97256947-97256969 CCACCCACCTTCCCACTTCACAC 0: 1
1: 0
2: 9
3: 61
4: 774
Right 911392027 1:97256999-97257021 GAAATCACAAAGCCAAAAATTGG 0: 1
1: 0
2: 2
3: 40
4: 503
911392018_911392024 7 Left 911392018 1:97256947-97256969 CCACCCACCTTCCCACTTCACAC 0: 1
1: 0
2: 9
3: 61
4: 774
Right 911392024 1:97256977-97256999 TGATTACCAACAAGTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911392018 Original CRISPR GTGTGAAGTGGGAAGGTGGG TGG (reversed) Intronic
900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG + Intronic
900581228 1:3410637-3410659 GTGCGGAGAGGGGAGGTGGGAGG + Intronic
901469829 1:9448603-9448625 GGGTGAAGTGGGAGGAGGGGCGG - Intergenic
901756227 1:11443186-11443208 GTGGTATGTGGGAAGGTGGTTGG - Intergenic
901771357 1:11531940-11531962 GAGGGAAGGGGAAAGGTGGGTGG - Intronic
902129089 1:14243115-14243137 GTGTGTAGTGGCATGGTGGAGGG - Intergenic
902176476 1:14654567-14654589 GTGTGACCTGGAAATGTGGGAGG - Intronic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
903195828 1:21687458-21687480 GTGTGAAGAGGAAAGGCAGGGGG + Intronic
903314285 1:22489054-22489076 CTGTGAGGTGGGAAAGTGGCAGG + Intronic
903680716 1:25094974-25094996 GTGTGTTGAGGGCAGGTGGGGGG - Intergenic
903886327 1:26543048-26543070 GGGGGAAGTGAGAAGGAGGGGGG + Intronic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904009692 1:27382722-27382744 GTGTTGGGTGGGAGGGTGGGCGG - Intronic
904035765 1:27557760-27557782 GTGTGTACTGGGCAGGTGTGGGG - Intronic
904423637 1:30409776-30409798 GTCTCTAGTGGGAAGGAGGGGGG + Intergenic
904478214 1:30777893-30777915 GTGTGAAGTGGGAGGAGGGCGGG - Intergenic
904703789 1:32375405-32375427 GTGTGAAGTGTACAGGTGGTGGG + Intronic
904876847 1:33661928-33661950 GTGTGTGGTGGGAGGGAGGGGGG - Intronic
905241279 1:36583181-36583203 GTGAGTGGTGGGTAGGTGGGTGG - Intergenic
905598470 1:39229843-39229865 GGCTGAGGTGGGAGGGTGGGAGG - Intronic
905892711 1:41527293-41527315 GTGTGAAGTGTGAGGGTGTGAGG - Intronic
905892883 1:41528205-41528227 GGGTGGAGTGTGAAGGTGTGAGG - Intronic
906588358 1:47000805-47000827 GTGGGAAGAAGGCAGGTGGGTGG + Intergenic
906904502 1:49875298-49875320 GTGTGGAGGGGGGAGGGGGGAGG - Intronic
907255258 1:53174044-53174066 GGGTGAAGAGGGAATGTGGAAGG - Intergenic
907393054 1:54171187-54171209 GTGGGAGATCGGAAGGTGGGAGG + Intronic
907429257 1:54402501-54402523 GGGTGAGGTGGGAAGGGTGGAGG - Intronic
907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG + Intronic
907750526 1:57258783-57258805 GATGGGAGTGGGAAGGTGGGAGG + Intronic
908258600 1:62321795-62321817 GTGTGGGGTGGGGAGGTGGGGGG - Intergenic
908339063 1:63157842-63157864 GTGCCCAGTGGGAAGTTGGGAGG + Intergenic
908718580 1:67097707-67097729 GGGAGAAGGGGGAATGTGGGTGG + Intronic
909134492 1:71780856-71780878 CTCAGAAGAGGGAAGGTGGGTGG - Intronic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910348617 1:86270115-86270137 GTGTGAAGTGGGGTGGAGTGGGG + Intergenic
910497587 1:87849603-87849625 GTGTGCAGCGGGGGGGTGGGGGG + Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911679411 1:100697598-100697620 GAGTGAAGAGGGAAGGAGGGTGG - Intergenic
912490337 1:110059299-110059321 GTGTTTACTGGGAGGGTGGGAGG + Intronic
913171444 1:116235923-116235945 GCCAGAAGTGGGAAGGTGGAAGG - Intergenic
913272716 1:117109809-117109831 GGGTGAGCTGGAAAGGTGGGAGG + Intergenic
913301009 1:117368244-117368266 CTGTGATGTGGGAAGGAAGGCGG - Exonic
913551646 1:119922600-119922622 GTGTAAAGGGGAAAGGTGGCGGG - Intronic
913963675 1:143357556-143357578 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
913992300 1:143626027-143626049 GCATGCAGTGGGAACGTGGGAGG + Intergenic
914058034 1:144183145-144183167 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
914121111 1:144783220-144783242 GTGGGAAGGGGGAAGGGAGGGGG + Intergenic
914248224 1:145901429-145901451 GTGTGAAGTGGGTAAGAGAGAGG - Intronic
914807632 1:151003167-151003189 GTGTGAAGGGGCAGGGTGTGGGG - Intronic
915215677 1:154339234-154339256 GTGTGAAGAGGAGAGTTGGGAGG + Intronic
915351095 1:155226795-155226817 GTGTGAGGTGGGGAGGCGGCAGG - Intergenic
915535157 1:156530929-156530951 GTGTGAAGTGGGGAGAGGGGTGG + Intronic
915598981 1:156910525-156910547 TACTGCAGTGGGAAGGTGGGAGG + Intronic
915951889 1:160195178-160195200 GGGTGATGTGGGGAGGTGGGAGG - Intronic
916420254 1:164631041-164631063 GTGTGGAGTGGGAGAATGGGAGG + Intronic
917028857 1:170668177-170668199 GTGTGGAGTGTGAATGGGGGTGG + Intronic
917441408 1:175072242-175072264 GGGTGGTGTGGGAAGGTGGGAGG - Intronic
917679660 1:177353037-177353059 GAGTGATGTGGGAAGGGGAGGGG + Intergenic
918332176 1:183471618-183471640 GTGGGAAGTGGGAAGGGAGGAGG + Intergenic
919226141 1:194705529-194705551 GTGTGAAGTCTGTAGATGGGAGG + Intergenic
919282291 1:195506758-195506780 GTCCTGAGTGGGAAGGTGGGGGG + Intergenic
919991233 1:202709774-202709796 GTGGGAAGTGGGGCGGGGGGTGG - Intronic
920570906 1:207016559-207016581 GTGTGGATTGGGAAGGAGGCAGG + Intronic
920701958 1:208224693-208224715 GAGTGAAGAAGGAAGGTGAGAGG + Intronic
921056300 1:211545119-211545141 GAGTAAACTGGGAAGATGGGAGG - Intergenic
921168300 1:212523323-212523345 GTCTGGATTGGGAAGCTGGGTGG + Intergenic
921809637 1:219497907-219497929 GTTTAAAGTGGGATGGTGGATGG - Intergenic
921959788 1:221022595-221022617 GTGTGAAGAGGGGAGGGAGGTGG - Intergenic
922203392 1:223425996-223426018 CTATGGAGCGGGAAGGTGGGTGG - Intergenic
922465623 1:225844248-225844270 GTGTGTAGAGGCAAGGTGGGTGG + Intronic
922615254 1:226957289-226957311 GTGTGAACCAGGGAGGTGGGGGG - Intronic
922618722 1:226978064-226978086 GTGTGCAGGGGTAAGGTGTGCGG - Intronic
922653996 1:227364952-227364974 GTGTGAAGTGGTCAGCTAGGAGG + Intergenic
923090604 1:230737875-230737897 GGGTGAAGTGGGAGGGGTGGGGG - Intergenic
923382170 1:233432039-233432061 TTTAGAAGTGGGAAAGTGGGAGG - Intergenic
924057660 1:240139748-240139770 GGGTGTGGTGGGAAGATGGGAGG + Intronic
924588191 1:245378327-245378349 GGGTTAGGTGGGGAGGTGGGGGG + Intronic
924740635 1:246792710-246792732 GTGGGATGTGGGGATGTGGGGGG - Intergenic
1062811527 10:469989-470011 GTGAGAGGTGGGGAGGTGGATGG + Intronic
1062904715 10:1172044-1172066 GTGGGATGTGGGAGGCTGGGTGG - Intergenic
1063726961 10:8647800-8647822 CTGGGTAGTGGGAATGTGGGAGG + Intergenic
1063880814 10:10530025-10530047 GTGTGAAGGGGAATGGTGAGTGG - Intergenic
1065178806 10:23104727-23104749 GTGTCAAGAGGGAAGATGGCTGG - Intronic
1065602136 10:27379889-27379911 GAGGGAGGTGGGCAGGTGGGTGG - Intergenic
1065856959 10:29838848-29838870 GGGTGAAGGGGGAAGGGGGGAGG + Intergenic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1066803456 10:39216526-39216548 GTGGGATGTGGGGAGGGGGGAGG + Intergenic
1067035616 10:42914318-42914340 GTGTGTAGAGGGAAGGTGCAAGG - Intergenic
1067079829 10:43206568-43206590 GTGTGCAGCGGGGAGCTGGGAGG + Intronic
1067283592 10:44891243-44891265 GGGTGGAGTGGGAGGCTGGGAGG + Intergenic
1068650524 10:59517764-59517786 GAGAGAAGTGGGAAGGAGGAGGG - Intergenic
1069088139 10:64166125-64166147 GTCTGAGGTGGCGAGGTGGGAGG - Intergenic
1069603139 10:69722185-69722207 GCGCTAAGTGGGAAGGTGGCAGG - Intergenic
1069704742 10:70451262-70451284 AGGGGAAGTGGGAAGGTGGGAGG - Intergenic
1069845228 10:71366389-71366411 TGGTGAAGTGAAAAGGTGGGAGG + Intergenic
1069961874 10:72083947-72083969 GTGTGGGGTGGGAAGCAGGGAGG + Intronic
1070350503 10:75587728-75587750 GTGAGAAGCTGGAAGATGGGTGG + Intronic
1070475584 10:76826111-76826133 GTGAGAACTGGGAAGAGGGGCGG - Intergenic
1070716726 10:78727850-78727872 GTTTGGAGGGGGAGGGTGGGTGG - Intergenic
1070920981 10:80186284-80186306 GACTGAAGGGGGAAGGAGGGGGG + Intronic
1070953898 10:80452382-80452404 GGATGGAGTGAGAAGGTGGGTGG - Intergenic
1070984225 10:80674208-80674230 TTGTGAAATGTGGAGGTGGGAGG - Intergenic
1071489822 10:86128629-86128651 GAGAGAAGTGGCAAGGTTGGTGG - Intronic
1071629224 10:87204403-87204425 GTGGGAGGGGGGAAGGTGGGGGG + Intergenic
1071718454 10:88120025-88120047 GGGGGAAGCGGGAAGGAGGGGGG + Intergenic
1071725694 10:88196216-88196238 GGGGAAAGTGGGAGGGTGGGAGG + Intergenic
1071864168 10:89707642-89707664 GTGTGAAGGGGGAAAGGGGATGG - Intronic
1072168798 10:92839821-92839843 GTGGGAGGTAGAAAGGTGGGGGG + Intronic
1072306730 10:94114909-94114931 GTGGGATGGGGGAAGGGGGGAGG - Intronic
1072311419 10:94159760-94159782 GTGGGGAGGGGGAAGGAGGGAGG - Intronic
1072575201 10:96693274-96693296 GGGTGGGGTGGGAAGTTGGGGGG - Intronic
1072671423 10:97432586-97432608 GTGTGACATGTGCAGGTGGGAGG - Exonic
1072726396 10:97816668-97816690 GTGAGAAATGGGATGGTGGCTGG + Intergenic
1073011007 10:100359577-100359599 GTGTGAACTGGGGAGGAGGGGGG - Intronic
1073012773 10:100374084-100374106 GTGTGTGGTGGGAGAGTGGGAGG + Intergenic
1073146147 10:101283136-101283158 GTATGCAGTGGGGAGGAGGGTGG + Intergenic
1073614260 10:104976908-104976930 GTGGGGTGGGGGAAGGTGGGAGG + Intronic
1074236501 10:111589777-111589799 GACTGTGGTGGGAAGGTGGGAGG + Intergenic
1074378092 10:112955090-112955112 GGGTGAGGTGGGGGGGTGGGAGG - Intronic
1074467329 10:113695220-113695242 GGGTGAACTGGGAAGAGGGGAGG - Intronic
1074585309 10:114762614-114762636 GGGTGAGGAGGGAAGGTGGTTGG - Intergenic
1075065301 10:119285326-119285348 GAGTACAGTGGGAGGGTGGGTGG + Intronic
1075077931 10:119363686-119363708 CTGGGAAGAGGGAAGCTGGGAGG + Intronic
1075585439 10:123653796-123653818 GGGAGAAGGGGGAAGGGGGGAGG + Intergenic
1075656241 10:124163001-124163023 GAGGGAAGGGGGAAGGAGGGAGG + Intergenic
1076002530 10:126923729-126923751 GTATGAAGTGGGGAGGGGGAGGG - Intronic
1076133820 10:128031007-128031029 TTTGGAAGTGGGGAGGTGGGAGG + Intronic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076364787 10:129914799-129914821 GGGTGCAGGGAGAAGGTGGGGGG - Intronic
1076521787 10:131085762-131085784 GTGTGCAGGGGGACTGTGGGAGG - Intergenic
1077111892 11:865615-865637 GTGAGGCGTGGGCAGGTGGGCGG + Intronic
1077248846 11:1551801-1551823 GAGTGGGGTGGGCAGGTGGGTGG - Intergenic
1078331878 11:10429090-10429112 CCATGAAATGGGAAGGTGGGAGG - Intronic
1078673110 11:13382506-13382528 GTGTGTTGTGGGCAGGGGGGCGG - Intronic
1078845004 11:15112632-15112654 GTGTGTATTGGGAAGTGGGGGGG + Intronic
1078870178 11:15336037-15336059 GGGTGAAGTGGCAAGGGGAGAGG + Intergenic
1078997954 11:16723323-16723345 TTGCGGAGGGGGAAGGTGGGAGG + Intronic
1079002950 11:16773043-16773065 GTGAGAAGTGGGTAAGTGGGAGG + Intergenic
1079282732 11:19102470-19102492 CTGTGAAGTGGCATGGGGGGTGG - Intergenic
1079960816 11:26920671-26920693 GCTTGAACTCGGAAGGTGGGGGG + Intergenic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1080984879 11:37450470-37450492 GGGTGGAGTGGGGAGGTGTGGGG + Intergenic
1081067124 11:38557685-38557707 GTGGGAATTGAGAAGGAGGGTGG - Intergenic
1081167784 11:39827492-39827514 TTGGTAAGTGGGAAGGTTGGTGG + Intergenic
1081280983 11:41209035-41209057 ATTTGAAGGGGAAAGGTGGGAGG + Intronic
1081706581 11:45185482-45185504 GAGTGAGGTGGGAGGGTGTGTGG + Intronic
1081757822 11:45557101-45557123 GTCTGGAGTGGGAAGGGGAGGGG + Intergenic
1081781386 11:45715524-45715546 GTTTGCTGGGGGAAGGTGGGAGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082915677 11:58433897-58433919 GTAGGAAGTGGGGAGGGGGGAGG + Intergenic
1083050167 11:59769864-59769886 GTGTGGGGGGGGAAGGTGTGTGG + Intronic
1083172172 11:60929482-60929504 GGGTGAACTGGGTAGGTGGGTGG - Intronic
1083758326 11:64802956-64802978 GGGTGAAGCGGGATGGGGGGCGG + Intronic
1083821649 11:65174951-65174973 GTGTGACATGTGCAGGTGGGAGG + Intergenic
1084061395 11:66677722-66677744 GTGTGATGTGGGGAGCTCGGGGG - Exonic
1084358516 11:68654536-68654558 GGGTGTAGTGGGAAGTGGGGAGG - Intergenic
1084608964 11:70188701-70188723 GTGTGATGGGGGCAGGTGTGTGG - Exonic
1084651093 11:70489973-70489995 GGGTAAAGCGGGAGGGTGGGCGG - Intronic
1084657105 11:70526002-70526024 GTCTGAATTGAAAAGGTGGGTGG - Intronic
1084777346 11:71386326-71386348 CTTTGGAGTGAGAAGGTGGGAGG + Intergenic
1085239059 11:75036641-75036663 TTGGGAGGTGGGAAGGGGGGAGG + Intergenic
1085329702 11:75637825-75637847 GAGGGAAGTAGGAAGGAGGGAGG + Intronic
1085397472 11:76213897-76213919 GTGTGAAGGGGGGATGTGGTGGG + Intergenic
1085446897 11:76606748-76606770 GTCTGGAGAGGGAAGGTGGCAGG - Intergenic
1086098205 11:83071588-83071610 GTGAGCGGTGGGGAGGTGGGGGG - Intronic
1086443634 11:86852013-86852035 GAGTGCAGTGGGCAGATGGGAGG - Intronic
1086870767 11:92033886-92033908 GGGTGAAGTGGGGAGGTGGGGGG - Intergenic
1086920943 11:92585952-92585974 ATGTGAAGGGAGAAGGTGGCTGG + Intronic
1087088602 11:94245038-94245060 GTGAGAGGTGGGAAGAGGGGTGG + Intergenic
1087324900 11:96709831-96709853 AGGTGAGGTGGGGAGGTGGGGGG - Intergenic
1088469412 11:110177257-110177279 GTGGGAAGTGGTGAGGTGGTGGG + Intronic
1088815714 11:113419485-113419507 GTGTTACGTGGGGAGGGGGGAGG - Intronic
1089013375 11:115147873-115147895 GTGTGAGGTGTGAAGTTGTGGGG + Intergenic
1089347259 11:117798259-117798281 GTGTGGAGTGCGAAGTTTGGAGG + Intronic
1089460075 11:118647864-118647886 GTGTGAAGAGGGCCAGTGGGGGG + Intronic
1089518347 11:119047870-119047892 GTGGGGAGTGGGAAGCTGGTAGG + Intronic
1090391731 11:126393306-126393328 ATGTGAGGTGGGTAGCTGGGTGG + Intronic
1090578239 11:128132262-128132284 TTGAGCAGTGGGAAGGTAGGAGG - Intergenic
1090895368 11:130967959-130967981 GCCTGAAGTGGGAAGGTTTGTGG + Intergenic
1091438498 12:494167-494189 GGCTGAGGTGGGGAGGTGGGAGG + Intronic
1091446253 12:545752-545774 GTGAGGAGTGGGGAGGTGAGAGG + Intronic
1091446298 12:545901-545923 GTGAGGAGTGGGGAGGTGCGAGG + Intronic
1091446404 12:546254-546276 GTAAGGAGTGGGGAGGTGGGAGG + Intronic
1091658037 12:2360160-2360182 GTGTGGGGTGGGGGGGTGGGGGG - Intronic
1091728837 12:2864922-2864944 GTGATGAGTGGGCAGGTGGGTGG + Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091837129 12:3593999-3594021 CTGTGAAGTGGGAGGGCTGGGGG + Intergenic
1092126722 12:6079893-6079915 GTGTGAGGTGGGGAGCAGGGAGG - Intronic
1092232859 12:6786631-6786653 GTAGGAAGTGTGGAGGTGGGTGG - Intergenic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092999317 12:13980632-13980654 GAGGGAAGTGGGAAGGAAGGAGG + Intergenic
1093000345 12:13988981-13989003 GTGTGAATTTGGAACATGGGAGG - Intergenic
1094044177 12:26148908-26148930 GTGTGCCGTGGGGAGGTTGGGGG - Intronic
1094529279 12:31258184-31258206 GTGGGAAGTGGGAATAGGGGTGG + Intergenic
1095584655 12:43836403-43836425 GGGTGAAGTGTCAAGGAGGGAGG + Intronic
1095785069 12:46101134-46101156 GTGTGAAGTCCGAGGGTGGGAGG + Intergenic
1096121729 12:49093027-49093049 GTATGGAGTGGGGAGGTGGGGGG - Intronic
1097161981 12:57053154-57053176 GTGGGATGTGGGGAGGGGGGAGG - Intergenic
1097188329 12:57207734-57207756 GTGGGAAGTGGCAAGGATGGGGG - Intronic
1097456220 12:59801938-59801960 GTGGGTAGTGGGAAGGTGAGCGG + Intergenic
1097769539 12:63566446-63566468 GGGTGGGGTGGGAATGTGGGGGG - Intronic
1098014624 12:66091455-66091477 AGGTGAGGTGGGAGGGTGGGAGG - Intergenic
1098359801 12:69643240-69643262 GTCTGCAGTGGGAAGGTGGCTGG - Intergenic
1099900750 12:88708997-88709019 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
1100336965 12:93640738-93640760 GTGTGACATGTGCAGGTGGGAGG + Intergenic
1100770932 12:97922263-97922285 GGGTGAAGTGCAAAGGAGGGTGG - Intergenic
1100847421 12:98674379-98674401 CTGGAAAGTGGGAAGGTAGGAGG - Intronic
1100938576 12:99699151-99699173 GTGTGAAGTGGGTGGCAGGGGGG - Intronic
1101215713 12:102579884-102579906 GTGGGATGTGGGGAGGGGGGAGG + Intergenic
1101361497 12:104031605-104031627 GTGTGACATGTGCAGGTGGGAGG - Intronic
1101855890 12:108442364-108442386 GCAGGAAGTGGGACGGTGGGTGG + Intergenic
1101945475 12:109133005-109133027 GTGTGGAGAGAGAAGGTGAGTGG - Intronic
1101998881 12:109544369-109544391 TTGTGAAGTGGGGCGGGGGGCGG + Intergenic
1102044640 12:109822199-109822221 GTGGGCAGTGGGGAGGTGGGTGG + Intronic
1102202095 12:111064237-111064259 GTGAGAAGTGTGCAGGTGAGAGG + Intronic
1102582181 12:113896659-113896681 GTGAGGAGAGGGAAGGCGGGAGG + Intronic
1103445819 12:120994427-120994449 GGGACACGTGGGAAGGTGGGAGG + Intronic
1103593827 12:122010952-122010974 ATGGGAAGTGGGTAGGTGGCGGG + Intergenic
1104172507 12:126295849-126295871 GAGGGAAGGGGGAAGGAGGGAGG + Intergenic
1104361618 12:128138490-128138512 CTGTGAGGTAGGAAGCTGGGGGG - Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105460685 13:20582801-20582823 GTGTGAAGTGGGGAGATTTGAGG + Intronic
1105703464 13:22951403-22951425 GTGTGAAGTGGGAAATCAGGGGG - Intergenic
1106318428 13:28616050-28616072 GCTTGAAGTTGGAGGGTGGGAGG - Intergenic
1106602408 13:31199663-31199685 GGGTGACGCGGTAAGGTGGGAGG + Intergenic
1106944432 13:34811099-34811121 GTGGAAAGTGGGAAGCAGGGGGG - Intergenic
1107113610 13:36723715-36723737 GTTAGAAGTGGAAAGGTAGGGGG - Intergenic
1107192105 13:37601541-37601563 GTGTGAAGAGAGACGGTGGGGGG - Intergenic
1108579992 13:51819799-51819821 GGGTGATGTGGGAAGATGAGGGG + Intergenic
1109585643 13:64398890-64398912 AAGGGAAGAGGGAAGGTGGGGGG + Intergenic
1110187197 13:72689132-72689154 GTGTGAAGTCTGAACATGGGAGG - Intergenic
1110868052 13:80420134-80420156 GGGAGAAGTGGGGAGATGGGGGG - Intergenic
1110931023 13:81216872-81216894 GTGTGATGTGGGAATCTTGGTGG + Intergenic
1110998228 13:82140597-82140619 GTGGGATGGGGGAAGGGGGGAGG + Intergenic
1111359245 13:87153001-87153023 GTGGGGAATGGGAAGGGGGGAGG + Intergenic
1112498309 13:99922921-99922943 GTGGAAAGTGGGCAGATGGGAGG + Intergenic
1113614569 13:111671304-111671326 GTCTGCGGTGGGAAGGAGGGCGG + Intronic
1113620037 13:111756218-111756240 GTCTGCGGTGGGAAGGAGGGCGG + Intergenic
1113750711 13:112774916-112774938 CCGTGACGGGGGAAGGTGGGAGG - Intronic
1113967936 13:114165145-114165167 GGGTGAGCTGGGAAGCTGGGGGG - Intergenic
1114713307 14:24800144-24800166 GAGTGAGTTGGGAAGGTGGCTGG + Intergenic
1114815240 14:25949689-25949711 GTTGGAAGTGGGAAGTGGGGTGG - Intergenic
1115770307 14:36659748-36659770 GTGAGAACTGGGAAGATGTGTGG + Intronic
1116579061 14:46615496-46615518 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
1116715731 14:48423822-48423844 GTGTGAAGTGAGAGGTGGGGCGG + Intergenic
1116808073 14:49512676-49512698 GTTTGAAGTGGGGTGGTAGGGGG - Intergenic
1117143113 14:52810009-52810031 GTCTGAAGTGGGGAGGTGGGGGG - Intergenic
1117627102 14:57651372-57651394 GAGTGAAGTGGGTCGGTGGTGGG + Intronic
1117848882 14:59946648-59946670 GTGAGGAGTGGGGAGGGGGGAGG - Intronic
1118364311 14:65081397-65081419 GTATGGAGTGGAAAGATGGGAGG - Intronic
1118487104 14:66224661-66224683 GTGAGAGGAGGGAAGGTGAGAGG - Intergenic
1118884972 14:69859015-69859037 AGGTGAAGGGGGCAGGTGGGAGG + Intronic
1119054352 14:71403987-71404009 CTGTGATGTGGGTGGGTGGGTGG - Intronic
1119432038 14:74574855-74574877 GGGAGAAGGGGGAAGGTAGGAGG + Intronic
1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG + Intergenic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121238351 14:92410034-92410056 ATTTGAGGGGGGAAGGTGGGAGG + Intronic
1121245918 14:92460770-92460792 CTGATAAGTGGGGAGGTGGGAGG + Intronic
1121678659 14:95774868-95774890 GGGCGGTGTGGGAAGGTGGGCGG + Intergenic
1121794737 14:96725514-96725536 CTGTGGGCTGGGAAGGTGGGAGG - Intergenic
1121876009 14:97453798-97453820 GGCTGAGGTGGGAAGGTGGGAGG + Intergenic
1121937894 14:98037292-98037314 ATGGGAAGTGGGAAGTGGGGAGG - Intergenic
1122092876 14:99351753-99351775 GTGTGAAGAGGGAAGGGAGGTGG - Intergenic
1122148175 14:99706538-99706560 CTGTGCAGAGTGAAGGTGGGTGG - Intronic
1122804749 14:104250647-104250669 GTGAAAAGGGGGAAGGAGGGAGG + Intergenic
1122879468 14:104683599-104683621 GTGTGTGGTGGGGAGGGGGGCGG - Intergenic
1123055593 14:105567849-105567871 GTGTGGTGTGGGCAGGTGTGTGG + Intergenic
1123208750 14:106738662-106738684 GTGTGGGGGGGGTAGGTGGGGGG - Intergenic
1202835425 14_GL000009v2_random:74546-74568 GAGTGAAAGGTGAAGGTGGGGGG + Intergenic
1202843877 14_GL000009v2_random:149001-149023 GTGTGAAGTGGGAAAATGGGGGG + Intergenic
1202913276 14_GL000194v1_random:139247-139269 GTGTGAAGTGGGAAATCGGGGGG + Intergenic
1123457803 15:20441774-20441796 GTGTAAAGTGAGAAAGTGTGTGG - Intergenic
1123503624 15:20915485-20915507 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1123560871 15:21489159-21489181 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1123597110 15:21926450-21926472 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1123660266 15:22558637-22558659 GTGTAAAGTGAGAAAGTGTGTGG + Intergenic
1124042541 15:26118550-26118572 GGGTGATGTGGGAAGGGGGATGG + Intergenic
1124314124 15:28653128-28653150 GTGTAAAGTGAGAAAGTGTGTGG + Intergenic
1125204865 15:37142547-37142569 GGGTGAGGTGGGAGGTTGGGGGG - Intergenic
1125530075 15:40407287-40407309 GTGGGAGGTGGGAAGGTGCTGGG + Intronic
1125998694 15:44188927-44188949 GTCAGAAGTGGAAGGGTGGGGGG + Intronic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127454288 15:59143340-59143362 GGGAGGAGTGGGCAGGTGGGTGG + Intronic
1127465650 15:59241975-59241997 CTGTGATGTGGGAAGCTGGGAGG + Intronic
1128067786 15:64775376-64775398 GCGGGAAGTGGGAAGGGGCGCGG + Exonic
1128166851 15:65473081-65473103 CTGGGAGGTGGCAAGGTGGGAGG + Intronic
1128529535 15:68434260-68434282 GTGTAATGTGGGAGGGTGAGGGG + Intergenic
1128695084 15:69755744-69755766 GCCTGAAGTGAGGAGGTGGGAGG + Intergenic
1128704568 15:69829197-69829219 GTGGGAAGTGGGGAGGAGGGAGG - Intergenic
1128799594 15:70489219-70489241 GGGGGAAGTGGGGACGTGGGGGG + Intergenic
1130100792 15:80892432-80892454 GTTTTAAGAGAGAAGGTGGGAGG - Intronic
1130371399 15:83287708-83287730 GGGGGAAGTGGGGAGGTGGGGGG + Intergenic
1130926561 15:88389918-88389940 GTGCAAAGTGGGAAGGTGTTTGG - Intergenic
1131229212 15:90647605-90647627 GTGTGAAGGGGGAGGGGGAGGGG - Intergenic
1132243198 15:100276232-100276254 GTGCCTGGTGGGAAGGTGGGAGG + Intronic
1202969216 15_KI270727v1_random:216323-216345 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1133381596 16:5335660-5335682 GTGTGGAGTGGCACGGTGTGGGG + Intergenic
1133641041 16:7717586-7717608 GTGTGAAGATGGGGGGTGGGGGG + Intergenic
1133869672 16:9675457-9675479 GTGTGAGGAGGGGAGGTGGTAGG + Intronic
1133924583 16:10182592-10182614 TTGGGAAGGGGGGAGGTGGGAGG - Intronic
1134750934 16:16624531-16624553 GTGTGAAGTGGAACGGAGTGTGG - Intergenic
1134777135 16:16863075-16863097 GTGTGAAGTGTAGAGGTTGGGGG + Intergenic
1134994520 16:18729060-18729082 GTGTGAAGTGGAACGGAGTGTGG + Intergenic
1135222475 16:20624854-20624876 GTGTGGTGGGGGCAGGTGGGTGG - Intronic
1135698469 16:24610773-24610795 GTGGAAAGGGGGAAGGTGAGAGG - Intergenic
1136024014 16:27458471-27458493 ATGGGAAGAGGGAAAGTGGGAGG + Intergenic
1136477787 16:30524331-30524353 GTGGGAAGTGGGTTGGAGGGAGG - Exonic
1136577815 16:31134754-31134776 GGCTGAGGTGGGGAGGTGGGAGG + Intronic
1137603088 16:49769749-49769771 GTGTGAAATGAGGTGGTGGGGGG - Intronic
1137628914 16:49928346-49928368 GTGTGGAGTGGGGATGTGGAGGG - Intergenic
1137758361 16:50920283-50920305 GTGTGAAGAGGGCAGCTGGCAGG + Intergenic
1137784296 16:51125190-51125212 GAGGGCAGAGGGAAGGTGGGAGG + Intergenic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1139136062 16:64206186-64206208 GGGTGAAGTGGGCAGGGTGGGGG + Intergenic
1139340401 16:66264558-66264580 GAGTGAGCGGGGAAGGTGGGGGG - Intergenic
1139480833 16:67229762-67229784 GTGGGCAGTGGGATTGTGGGGGG + Intronic
1139525977 16:67516959-67516981 GTGTTAAGTGAGAAGGAGGAAGG + Intergenic
1139573688 16:67828451-67828473 GTGAGAAGGCGGAAGGTGTGGGG - Intronic
1139875867 16:70145508-70145530 CAGTTAGGTGGGAAGGTGGGAGG - Intronic
1140295084 16:73702162-73702184 GTGTGAACGGGGAGGGTGGGGGG - Intergenic
1140359920 16:74335590-74335612 CAGTTAGGTGGGAAGGTGGGAGG + Intergenic
1140407653 16:74721727-74721749 CTGTGAAGTAGGAAGCTGGGTGG - Intronic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141498250 16:84425199-84425221 GTAGGGACTGGGAAGGTGGGTGG - Intronic
1141545399 16:84764319-84764341 TGGTGAAGGGGGAAGGTGTGAGG + Intronic
1141935803 16:87237040-87237062 GTGTTAAGCGGGAGGGTGGCAGG - Intronic
1142157914 16:88541018-88541040 GTGTGGCGTGTGCAGGTGGGGGG + Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142352275 16:89585891-89585913 GTGTCAGGTGAGGAGGTGGGGGG + Intronic
1142694025 17:1623583-1623605 GAGAGAAGTGGGAAGGGGCGGGG - Intronic
1142950937 17:3479585-3479607 TGGTGCAGTGGGAAGGTGGAAGG - Intronic
1143032987 17:3978031-3978053 CTGTGAAGTGGGAAGCACGGCGG + Intergenic
1143329347 17:6121967-6121989 CAGGGAGGTGGGAAGGTGGGTGG + Exonic
1143432971 17:6900356-6900378 GTGTGGTGGTGGAAGGTGGGAGG + Intronic
1143485244 17:7250750-7250772 GTGTCAAGGGTGGAGGTGGGTGG - Intronic
1144421914 17:15106702-15106724 CTGTGAAGAATGAAGGTGGGTGG - Intergenic
1144497087 17:15754819-15754841 CTGGGAAGTGGCATGGTGGGGGG - Intergenic
1144625152 17:16840672-16840694 GGGTGAAATGGGAAGGAGTGAGG - Intergenic
1144881277 17:18432049-18432071 GGGTGAAATGGGAAGGAGTGAGG + Intergenic
1145150955 17:20512337-20512359 GGGTGAAATGGGAAGGAGTGAGG - Intergenic
1145210789 17:21011513-21011535 GTGTGAACTCGGAAGGCGAGGGG + Intronic
1145786220 17:27595616-27595638 GGGTGAAGGGAGAAAGTGGGGGG - Intronic
1146532747 17:33623880-33623902 GTGACAGATGGGAAGGTGGGGGG - Intronic
1146943558 17:36859772-36859794 GAGGGAGGTGGGATGGTGGGGGG + Intergenic
1147314236 17:39611974-39611996 GTGTGTGGAGGGGAGGTGGGAGG + Intergenic
1147579305 17:41619371-41619393 GGGTGAAATGGGAAGGAGTGAGG - Intergenic
1148377065 17:47158194-47158216 ATGTGAAATAGGTAGGTGGGTGG - Exonic
1148469224 17:47883253-47883275 GTGGGGAGAGGTAAGGTGGGCGG - Intergenic
1148695295 17:49555126-49555148 GTCTGTAGTGGGAAGGTCGGGGG - Intergenic
1149080837 17:52655306-52655328 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
1149439697 17:56663981-56664003 GGGTGGACTGGGAAGATGGGGGG - Intergenic
1149560838 17:57606879-57606901 GTGTGAGGTGGGGTGATGGGGGG + Intronic
1150803407 17:68300038-68300060 GGCTGAAGTGGGAAGATGGCTGG - Intronic
1151190497 17:72394477-72394499 ATGGGAAGTTGGAAGGTGAGGGG + Intergenic
1151311020 17:73292484-73292506 GTGTGTAGTGTGAGTGTGGGGGG + Intronic
1151322440 17:73360001-73360023 CTGAGAGGTGGGGAGGTGGGAGG - Intronic
1151529475 17:74695372-74695394 GAGTGAAGGGGGAAGCTGGAGGG - Intronic
1151694202 17:75705729-75705751 ATGTGAGGTGGGGCGGTGGGCGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152112694 17:78365967-78365989 GCGGGCAGTGGGTAGGTGGGTGG - Intergenic
1152143654 17:78554028-78554050 GACTGAAGTGGGAAGATGGCTGG - Intronic
1152409678 17:80117158-80117180 GGGTGGAGGGGGCAGGTGGGAGG - Intergenic
1153019565 18:614574-614596 GTGAGAAATGGGAGGGTGAGAGG - Intronic
1153083371 18:1254883-1254905 GCGGGATGTGGGAATGTGGGTGG + Intergenic
1153507690 18:5818818-5818840 GTGGGGGGTGGGGAGGTGGGGGG + Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1153985650 18:10348634-10348656 GTGAGGAGTGGGAAGGGGAGGGG + Intergenic
1154098444 18:11444172-11444194 GTGGGGAGAGGGAAGGGGGGAGG - Intergenic
1156043904 18:32856795-32856817 GTGGGGAGGGGGAAGGGGGGAGG - Intergenic
1156129398 18:33952134-33952156 GTTTGTGGTGGGAAGCTGGGTGG + Intronic
1156284222 18:35675125-35675147 GTTTGAAGTGGGTAGGGGGATGG - Intronic
1156437367 18:37147033-37147055 GTGAGAGGTGGGAAGGAGAGGGG - Intronic
1156457278 18:37301907-37301929 GGGGGAAGGGGAAAGGTGGGTGG - Intronic
1157543188 18:48526872-48526894 AGGTGAAATGGGAAGATGGGAGG + Intergenic
1157547829 18:48559795-48559817 GTGAAAGGTGGGAAGGTGAGAGG + Intronic
1158208517 18:55021161-55021183 ATGTGAAGTGGGAGGGAGGTAGG - Intergenic
1159588459 18:70305122-70305144 GTTTGAAGCCGGGAGGTGGGAGG + Intronic
1160492497 18:79349900-79349922 GTGTGAAGGTGCATGGTGGGGGG - Intronic
1160632873 18:80258670-80258692 GTGTGGGGTGGGTGGGTGGGGGG + Intergenic
1160686814 19:440711-440733 GCGTGAAGTGGGAGGGAGGTGGG + Intronic
1160872128 19:1282365-1282387 GTATGAAGGGGGAAGGAAGGAGG + Intergenic
1160975592 19:1790734-1790756 GTAAGAAGTGGGGAGTTGGGGGG - Intronic
1161026425 19:2039346-2039368 GTGAGCAGAGGGTAGGTGGGTGG - Exonic
1161974054 19:7599257-7599279 GAGTGCAGTGGGTAGGTGGGTGG - Intronic
1161974100 19:7599424-7599446 GAGTGCAGTGGGTAGGTGGGTGG - Intronic
1162826096 19:13253144-13253166 GTGGGAAGTGGGAAGTGGGGAGG + Intronic
1162870214 19:13580854-13580876 GGCTAAGGTGGGAAGGTGGGAGG - Intronic
1163229297 19:15989303-15989325 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
1163342963 19:16721618-16721640 GTGAGTTGTGGGAAGGTGGCTGG + Intronic
1163752165 19:19084371-19084393 GTTTGGGGAGGGAAGGTGGGTGG - Intronic
1164189575 19:22901801-22901823 GGCTGTGGTGGGAAGGTGGGCGG + Intergenic
1164816741 19:31209895-31209917 GTGTGGAGTGGTTGGGTGGGGGG + Intergenic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165707819 19:37988876-37988898 GTGTGGAGTGGGAGGGAGGACGG - Intronic
1166219902 19:41357654-41357676 GCAGGAGGTGGGAAGGTGGGGGG - Intronic
1166251038 19:41570917-41570939 GGGTGAAGTGGGGAAGTGGTGGG + Intronic
1166760015 19:45218355-45218377 AAGTGAAGAGGGAGGGTGGGAGG - Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1167421103 19:49403855-49403877 GTGTGGAGGGGGAAGGTAGAGGG - Intronic
1167703545 19:51065255-51065277 GGGTGCAGTGGCGAGGTGGGAGG + Intergenic
1167706937 19:51086678-51086700 GTGTGGAGAGGGTAGGAGGGAGG + Intergenic
1168172314 19:54596892-54596914 GAGTGAAGGGGGAAGGTCTGCGG + Intronic
1168338249 19:55608880-55608902 GTATGAAGTGGGATTGGGGGCGG + Intronic
1168602029 19:57726104-57726126 GGGTGGGGTGGGGAGGTGGGAGG - Intronic
1202697518 1_KI270712v1_random:135813-135835 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
925248970 2:2413044-2413066 GTGGGATGGGGGAAGGGGGGAGG - Intergenic
925351149 2:3201395-3201417 GAGTGAAATAGGAAGGTGGGAGG - Intronic
925410544 2:3637425-3637447 CTGTGATGTAGGAAGGAGGGCGG + Intronic
925542857 2:4985188-4985210 GTGGGGAGTGGGAAGGAGAGGGG + Intergenic
925861783 2:8184552-8184574 GTGTGGTGTGGGGAGTTGGGAGG + Intergenic
926046610 2:9714725-9714747 ATGTTAAGTGGGCAGCTGGGTGG + Intergenic
926406799 2:12561850-12561872 GTGTAGAGAGGGAAGGTGGAGGG + Intergenic
926645857 2:15289187-15289209 GGCTGAGGTGGGTAGGTGGGTGG - Intronic
927095207 2:19743031-19743053 TTGTGAAGTGGGTAGGGTGGGGG - Intergenic
927155102 2:20216793-20216815 GTGGGATGTGGGGAGGTTGGAGG - Intronic
927320452 2:21738329-21738351 GTGGGGAGTGGGAAGGTTGATGG + Intergenic
927321723 2:21755106-21755128 TTGTGAAGTGGTAAGGTAGAAGG + Intergenic
927670656 2:25066110-25066132 GTGTGACGTGGGGAGGTGGGGGG - Intronic
927871616 2:26627754-26627776 GTGAGGGGTGGGTAGGTGGGTGG - Intronic
928136730 2:28693505-28693527 GGGGGAAGTTGGAGGGTGGGAGG - Intergenic
928326923 2:30326623-30326645 TGGGGCAGTGGGAAGGTGGGTGG - Intergenic
929485458 2:42349440-42349462 GTGGGAGTTGGGATGGTGGGAGG + Exonic
929596241 2:43178124-43178146 GTGTGCAGTGGGACGCTGAGGGG - Intergenic
929796855 2:45066341-45066363 GTCTGATGTTTGAAGGTGGGAGG + Intergenic
930128986 2:47829002-47829024 ACTTGAAGTGGGGAGGTGGGAGG - Intronic
930526508 2:52536881-52536903 GTGGGGTGGGGGAAGGTGGGAGG + Intergenic
930583923 2:53247572-53247594 GTGTGAGGTGGGGGGTTGGGGGG + Intergenic
931706297 2:64949033-64949055 GGCTGAGGTGGGAAGATGGGTGG + Intergenic
932271271 2:70412269-70412291 GTGGGAAGTGGGGTGGTGAGTGG + Intergenic
932481514 2:72042221-72042243 GTGTGAGGTGGGCAGGGGGATGG + Intergenic
932701332 2:73993983-73994005 GGGTGTGGTGGGTAGGTGGGTGG + Intronic
932716020 2:74101225-74101247 CTGTGAAGTGGGAAGGGGCCAGG - Exonic
932904796 2:75738333-75738355 GTTTGCAGTGGGCGGGTGGGAGG - Intergenic
933019059 2:77167800-77167822 ATGGGATGGGGGAAGGTGGGAGG + Intronic
933395722 2:81728506-81728528 ATGTGAACTTGGGAGGTGGGTGG + Intergenic
935126075 2:100223991-100224013 CTGTGAAGTGGGCAGTTGGTGGG - Intergenic
935593017 2:104857724-104857746 CTCTGAAATGGGAAGGAGGGGGG + Exonic
936631637 2:114209437-114209459 AGGAAAAGTGGGAAGGTGGGTGG + Intergenic
936690861 2:114886904-114886926 GGGTGGAGTGGGAAGGCAGGTGG - Intronic
937118685 2:119427323-119427345 TTGAGGAGTTGGAAGGTGGGAGG - Intergenic
937307483 2:120881379-120881401 GTGGGGAGAGGGCAGGTGGGGGG + Intronic
937376175 2:121337247-121337269 GTGTGCGGTGACAAGGTGGGAGG - Intergenic
937387805 2:121452948-121452970 TTGTGAATTGGGAAGGTTGTAGG - Intronic
938537905 2:132260024-132260046 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
938995731 2:136675492-136675514 GTGTGTAGTGGGGAGGGGGGTGG - Intergenic
939309952 2:140463169-140463191 GTGGCCAGTGGGAGGGTGGGTGG + Intronic
940799788 2:158120801-158120823 GTGTGTGGTGAAAAGGTGGGGGG + Intronic
942599042 2:177621210-177621232 GGCTGAAGTGGGCAGGAGGGAGG + Intergenic
942603099 2:177661269-177661291 GTGGGAAGTGTGCAGGTGGCAGG - Intronic
942884280 2:180903316-180903338 GCTTGAGGTGGGAGGGTGGGAGG + Intergenic
943030482 2:182679895-182679917 GTGGGTAGGGGGAAGATGGGAGG + Intergenic
943848229 2:192679419-192679441 GTGTGTAGTGGCCTGGTGGGAGG + Intergenic
944320831 2:198339819-198339841 TTGGGAACTGGGTAGGTGGGGGG + Intronic
946453940 2:219806086-219806108 GTGGGAAGTGGGAAAGAGGTGGG - Intergenic
946704742 2:222447254-222447276 GTGAGAAGTAGGGAGGTGGGTGG - Intronic
947293437 2:228603280-228603302 GTGAGCATTGGGAAGTTGGGGGG + Intergenic
947331670 2:229035451-229035473 GTGAGTAGAGGGAAGGAGGGGGG - Intronic
947828063 2:233119915-233119937 GATTGACGTGGGCAGGTGGGAGG - Intronic
948075779 2:235164171-235164193 TTCTCAAGGGGGAAGGTGGGGGG + Intergenic
948091881 2:235302039-235302061 GAGAGAAGGGGGAAGGAGGGAGG - Intergenic
948180814 2:235978504-235978526 GTGTGGTGTTGGCAGGTGGGTGG + Intronic
948231282 2:236351306-236351328 GGGAGAAGTGGGCGGGTGGGGGG + Intronic
948653220 2:239462051-239462073 GAGTGAAGAGGGAGGGTGGCCGG - Intergenic
948695676 2:239732066-239732088 GGGTGGAGTGGGAGGGTGGGAGG - Intergenic
948753842 2:240147407-240147429 GTGTTAAGTGGGTGGGTGTGGGG + Intergenic
948959913 2:241326503-241326525 TTGAGAAGAGGCAAGGTGGGGGG - Intronic
948959935 2:241326652-241326674 TTGAGAAGAGGCAAGGTGGGGGG - Intronic
949001295 2:241615747-241615769 GAGTGAAGAGGAGAGGTGGGAGG - Intronic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1169868161 20:10222511-10222533 GGGTGGAGTGGGAAGCTTGGAGG + Intronic
1170545656 20:17433887-17433909 GAGAGAAGTAGGAAGGGGGGGGG - Intronic
1170629357 20:18055085-18055107 GTGTGCTGGGGGAAGGGGGGCGG - Intronic
1170930568 20:20766602-20766624 GTGAGCACTGGGTAGGTGGGTGG + Intergenic
1171749393 20:29033581-29033603 GTGTTAAGGGGGATGGCGGGAGG - Intergenic
1171858867 20:30376747-30376769 GAGTGCTGTGGGAATGTGGGCGG - Intergenic
1171913858 20:30993593-30993615 GTGGGAAGGGGGGAGGGGGGAGG + Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172117166 20:32579896-32579918 GTGTGGGGTGGGGAGGAGGGAGG - Intronic
1172789215 20:37490976-37490998 GAGTGTAGAGGGAAGATGGGAGG - Intergenic
1174127243 20:48315611-48315633 GTGTGGGGTGGGGAGGTGGAGGG + Intergenic
1174298772 20:49567818-49567840 GTGCAAGGTGGGAAGGTGCGGGG - Intronic
1174390963 20:50218019-50218041 GGGTGAAGTGAGAAAGTGGTTGG + Intergenic
1174532298 20:51223784-51223806 GTGTTAAGTGGCAAGGAGGACGG + Intergenic
1174572355 20:51511100-51511122 GTGACATGTGGGAATGTGGGTGG - Intronic
1174677921 20:52376157-52376179 GGGTGAAGTGGGTTGGTAGGTGG - Intergenic
1174845700 20:53941124-53941146 GTGTGAAGTGGGAGGAGGGAGGG + Intronic
1175014544 20:55775292-55775314 GTGTGTAGTGGGTAGGTGCTAGG - Intergenic
1175281198 20:57805145-57805167 GTGTGAAATGGGAACATGGCAGG - Intergenic
1175337439 20:58205620-58205642 GTGGGGAGTGGGGACGTGGGAGG - Intergenic
1175337476 20:58205778-58205800 GTGGGGAGTGGGGACGTGGGAGG - Intergenic
1175384803 20:58587282-58587304 GTGTGTGGTGGGATGGTAGGGGG + Intergenic
1175469872 20:59219903-59219925 GGGTTCAGTGGGCAGGTGGGTGG + Intronic
1175489912 20:59372965-59372987 GTGTCAAGTAGGAGGATGGGGGG - Intergenic
1175498065 20:59428884-59428906 CAGTGAAGTGGGAACATGGGAGG + Intergenic
1175654763 20:60760533-60760555 CTCTGTAGTGGGGAGGTGGGTGG - Intergenic
1176315784 21:5242111-5242133 GTGTTAAGGGGGATGGCGGGTGG + Intergenic
1176632628 21:9153917-9153939 GTGTGAAGTGGGAAATCGGGGGG + Intergenic
1177051259 21:16237763-16237785 GTGGGAAGGGGAAAAGTGGGAGG + Intergenic
1178287929 21:31341059-31341081 GAGAGAAGTGGAAAGGTTGGAGG + Intronic
1178546261 21:33495413-33495435 GCTTGAGGTGGGAGGGTGGGAGG + Intergenic
1179258408 21:39737635-39737657 GAGGGATGTGGGAAGGGGGGCGG + Intergenic
1179805270 21:43833199-43833221 GAGTCAAGTGGGAAGGTGGCCGG - Intergenic
1180393584 22:12308056-12308078 GTGTTAAGGGGGATGGCGGGAGG + Intergenic
1180406162 22:12556696-12556718 GTGTTAAGGGGGATGGCGGGAGG - Intergenic
1180901312 22:19375429-19375451 CCTTGAAGTGGGAAGGTGGCTGG - Intronic
1180996046 22:19965811-19965833 GTGGGCATTGGGAGGGTGGGAGG + Intronic
1181163012 22:20968659-20968681 GAGAGAAGAGGGAAAGTGGGGGG - Intronic
1181182519 22:21078025-21078047 GTGTGAGCTGGGGTGGTGGGAGG - Intergenic
1181468334 22:23122721-23122743 ATGGGCAGTGGGAAGATGGGGGG + Intronic
1182311143 22:29408401-29408423 GTCTGGAGTGTGGAGGTGGGCGG - Intronic
1182415173 22:30216798-30216820 GTGTGAAGGAGGAGGGTGTGAGG + Intergenic
1182512167 22:30827213-30827235 ATGTGAAGTGGGGAGTTGTGAGG + Intronic
1182675052 22:32032541-32032563 GTGTGAGGAGAGGAGGTGGGGGG - Intergenic
1183350677 22:37333057-37333079 GTGTGCAGGGAGAAGGTCGGGGG - Intergenic
1183416933 22:37688016-37688038 GTACGCAGGGGGAAGGTGGGAGG + Intronic
1184074425 22:42167147-42167169 GAGCAAAGTGGGGAGGTGGGTGG - Intronic
1184270325 22:43377521-43377543 GTCAGAAGTGTGAAGGTAGGTGG + Intergenic
1184320302 22:43736888-43736910 GAGTGAACTGGAAAGATGGGGGG - Intronic
1184410440 22:44323102-44323124 GGGTGAGGTGGGTAGATGGGTGG - Intergenic
1185345711 22:50309665-50309687 GTGTGAAGGGGGAACTTGAGGGG - Exonic
1185417202 22:50716707-50716729 GTGTGGAGTGTGATGGTGGCTGG - Intergenic
949327870 3:2887384-2887406 GTGTGGAGAGTGAGGGTGGGGGG + Intronic
949431373 3:3979743-3979765 GTCTGTAGTGGGAAGGATGGGGG - Intronic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
950085551 3:10254991-10255013 GTGGGAAGTGGGAAGGAGGAAGG - Intronic
950454848 3:13086572-13086594 GAGTGCAGTGGGAAGCTGGCGGG - Intergenic
951058854 3:18180541-18180563 GTGTGAAGTAAGAAGGGGTGAGG - Intronic
951399089 3:22208444-22208466 GTGTGGGGTGGGTAGATGGGTGG + Intronic
952167076 3:30762025-30762047 ATGTGACGTGGGTAGGTGAGAGG + Intronic
952692380 3:36225071-36225093 GTGGGAGGTGAGATGGTGGGAGG - Intergenic
952955469 3:38554632-38554654 GGGTAGAGTGGGAGGGTGGGTGG - Intronic
953195400 3:40727511-40727533 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
954167022 3:48768049-48768071 GGCTGAGGTGGGGAGGTGGGTGG + Intronic
954753980 3:52829084-52829106 GTGTGGAGAGGGGAGGAGGGTGG + Intronic
954817111 3:53291467-53291489 AAGGGTAGTGGGAAGGTGGGGGG - Intronic
955126014 3:56113732-56113754 ATCTGAAGTGGGAGGGTGGGGGG - Intronic
955219432 3:57011556-57011578 GGGTGGCGGGGGAAGGTGGGGGG - Intronic
956024557 3:64969279-64969301 GAGTGAATTGGGGGGGTGGGCGG - Intergenic
956192623 3:66621977-66621999 TTGGGATGTGGGAAGGTAGGGGG + Intergenic
956267281 3:67411269-67411291 GTGTGAAGTGTGAATCTGTGTGG - Intronic
956666539 3:71647512-71647534 GTGTGAATTGAGAAGGTATGAGG - Intergenic
956805638 3:72808320-72808342 GTGGGTTGTGGGAAAGTGGGTGG - Intronic
956947371 3:74238484-74238506 GGGGGAAGGGGGAAGGGGGGAGG - Intergenic
959333730 3:105038334-105038356 GAGTGAAGTGGGAAGATGAGTGG + Intergenic
960140802 3:114150305-114150327 GAAAGAAGTGGGAAGGTGGCTGG - Intronic
960692664 3:120363187-120363209 GTGTGTGGTGGGGAGGAGGGCGG + Intergenic
960878569 3:122321598-122321620 TGGTGAAGAGGGAAAGTGGGGGG - Intergenic
961386290 3:126525053-126525075 GTGTGAAATGGGTTGATGGGAGG - Intronic
961471873 3:127120237-127120259 GTGTGAAGTGGGAAGCTTTACGG + Intergenic
961877905 3:130038202-130038224 GAGTGAGGTGGGCAGATGGGAGG - Intergenic
961928527 3:130509141-130509163 GTGTGAAGAGGGGAGGAGCGTGG - Intergenic
962063500 3:131954638-131954660 ATGGGATGGGGGAAGGTGGGAGG - Intronic
962317040 3:134365398-134365420 GTGTGCAATGGGAATGTGAGAGG - Intronic
962478383 3:135777886-135777908 AGCTGAAGTGGGAAGGAGGGAGG - Intergenic
963116669 3:141736262-141736284 GCGGGAAGTGGGAAGGCAGGTGG - Intergenic
963502549 3:146146488-146146510 GTGGGAACTGGGGAGGAGGGCGG + Intronic
963630937 3:147729137-147729159 GTGGGATGGGGGAAGGGGGGAGG + Intergenic
963701894 3:148637087-148637109 AAATGTAGTGGGAAGGTGGGCGG + Intergenic
964160675 3:153641204-153641226 GTGTGAAGAGGGATGGGTGGTGG - Intergenic
964270987 3:154956659-154956681 CAGTGAAGTGGGGAAGTGGGTGG + Intergenic
964848048 3:161065003-161065025 GTTGGAAGTGGGAAGGATGGGGG - Intronic
964886215 3:161486215-161486237 GTGTGAAGAGTGAGGGAGGGTGG - Intergenic
965942464 3:174201321-174201343 GCGGGAGGAGGGAAGGTGGGAGG + Intronic
966355571 3:179074903-179074925 GGGTGAAGTGGGGAGGCAGGTGG - Intergenic
966820368 3:183919679-183919701 GTGGGGAGTGGAAAGGTGAGTGG - Intergenic
967152760 3:186664814-186664836 TTCTGAAGTGTGAAGGTAGGGGG + Intronic
967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG + Intergenic
968381881 4:103456-103478 GGGTGAGGAGTGAAGGTGGGTGG - Intergenic
968593963 4:1473028-1473050 GTAGGGAGTGGGCAGGTGGGAGG - Intergenic
968990134 4:3905236-3905258 GAGTGCAGTGGGCAGATGGGAGG - Intergenic
969410722 4:7026278-7026300 GTGGGAAGGGGAGAGGTGGGAGG - Intronic
969445980 4:7244949-7244971 GTGGGCAGTTGGAAGGGGGGTGG + Intronic
969518457 4:7661848-7661870 GTGCTAAGTGTGGAGGTGGGGGG + Intronic
969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG + Intronic
970273848 4:14375901-14375923 GTGCGGAGTTGGGAGGTGGGGGG + Intergenic
970906245 4:21219715-21219737 GTTTCAAGTGGGAAGGTGTTTGG + Intronic
971162592 4:24148459-24148481 GGGAAAGGTGGGAAGGTGGGAGG - Intergenic
972123314 4:35732673-35732695 GTGGGAGGAGAGAAGGTGGGAGG - Intergenic
973563978 4:52165348-52165370 GTGTGAGGGGGGAGGGTGGGGGG - Intergenic
974447909 4:62010304-62010326 GTGTTGAGGGGGAAGGTGTGTGG - Intronic
974635779 4:64563005-64563027 GTGCGGAGTGGGAAATTGGGGGG - Intergenic
975151272 4:71023804-71023826 GTGGGGAGTGGGAGGTTGGGAGG - Intronic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
976144737 4:82031529-82031551 GTGTGACTGGGGAAGATGGGGGG - Intronic
976514812 4:85953238-85953260 GTGTGAACTGAGTATGTGGGTGG - Intronic
977058778 4:92229310-92229332 GCTTGAGGGGGGAAGGTGGGAGG + Intergenic
977151203 4:93514406-93514428 GTGTGTACTGTGGAGGTGGGGGG - Intronic
977911448 4:102541841-102541863 GTGTGAGGTTGGAAGGAGAGAGG - Intronic
978705087 4:111698437-111698459 GGGGGAAGTGGGAGGGAGGGGGG + Intergenic
979082860 4:116364077-116364099 GTCTGAGGGTGGAAGGTGGGAGG - Intergenic
979473824 4:121131628-121131650 GTGTGGAGTGGGTGGGTAGGGGG + Intronic
979903282 4:126251190-126251212 GTGGGATGGGGGAAGGAGGGAGG - Intergenic
980715109 4:136617511-136617533 ATGTAAAGTGGAAAGGTGAGAGG - Intergenic
980931802 4:139189184-139189206 GTGAGAAGTGGGAAAGAGGAAGG + Intergenic
981182246 4:141759595-141759617 GGGTGAAGTGGAAATGTGAGAGG - Intergenic
981265805 4:142782124-142782146 GTGGGGTGTGGGAAGGGGGGAGG - Intronic
981736055 4:147951427-147951449 TTGTGAAATGGGAATGTAGGGGG + Intronic
981750654 4:148090255-148090277 GTGTGACGAGGGAAGGGAGGAGG + Intronic
982274256 4:153623133-153623155 GTGTGGACTGGGTACGTGGGAGG - Intronic
982683086 4:158456216-158456238 ACTTGAAGGGGGAAGGTGGGAGG + Intronic
982895169 4:160911446-160911468 GTCTGCAGTGGGGTGGTGGGGGG + Intergenic
982933398 4:161437766-161437788 GTGAGAAGTGAGATGGTGGATGG + Intronic
983074186 4:163305158-163305180 GTCTCAAGTGGGAAGGAAGGAGG - Intergenic
983693632 4:170502354-170502376 GTGTGCATTTGGAAGGTGGGAGG + Intergenic
983934601 4:173492590-173492612 GTATGAAGTGGAAAGGCTGGAGG + Intergenic
983964393 4:173791888-173791910 GTGGGATGGGGGGAGGTGGGAGG + Intergenic
983985528 4:174055343-174055365 GCGTGAGGGTGGAAGGTGGGAGG - Intergenic
984781369 4:183529132-183529154 GGCTGAGGTGGGAGGGTGGGAGG + Intergenic
984815368 4:183831124-183831146 GCGTGAGGGGGGATGGTGGGGGG + Intergenic
985102261 4:186470305-186470327 TTGGGAGGTGGGAGGGTGGGTGG + Intronic
1202764518 4_GL000008v2_random:138660-138682 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
985781171 5:1872557-1872579 GTGTGTAGTGGTAGGGGGGGTGG + Intergenic
986136312 5:4982359-4982381 GTGTGCAGGGGGCAGGCGGGGGG + Intergenic
986313354 5:6571075-6571097 GAGGGAAGAGGGAAGGAGGGTGG + Intergenic
987026272 5:13929853-13929875 GTCTGAATTGGGAAGCAGGGTGG + Intronic
987147732 5:15008794-15008816 CAGTGATGTGGGAAGGTGGGAGG + Intergenic
988415299 5:30939743-30939765 ATGTGGAGTGGGAAGGAGGCAGG - Intergenic
989119696 5:37991915-37991937 GTTTGAAGTGTGGAGGTTGGAGG + Intergenic
990446183 5:55896578-55896600 GAGGGGAGGGGGAAGGTGGGGGG - Intronic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
991595346 5:68298892-68298914 GTATCAAGTGGGGTGGTGGGAGG + Exonic
991646691 5:68808025-68808047 GGAAGAAGTGGGAAGGAGGGAGG + Intergenic
992037392 5:72793771-72793793 GGGTGAGGTGGGTAGGAGGGTGG - Intergenic
992503290 5:77362701-77362723 GTGTGACTTGGGAAGGTGGCAGG - Intronic
993401788 5:87462355-87462377 CTGTGAAGTGGGTGGGTGTGGGG - Intergenic
993644206 5:90443161-90443183 GTGGGGAGTGGGGAGGGGGGAGG - Intergenic
993730818 5:91420519-91420541 GTGGGGTGGGGGAAGGTGGGAGG + Intergenic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
994682717 5:102909131-102909153 GAGAGAATTGGGAAGGTGTGAGG - Intronic
995271807 5:110228184-110228206 TGGTGAAATGGGTAGGTGGGTGG - Intergenic
995544676 5:113218102-113218124 GGGTGAGGTGGGAAACTGGGGGG + Intronic
995580395 5:113594250-113594272 ATGTGACGAGGGAAGGAGGGAGG - Exonic
995582079 5:113612967-113612989 GGGTCAAGTGGGAATGTTGGAGG + Intergenic
995986870 5:118187320-118187342 GGGGAAAGTGGGATGGTGGGAGG - Intergenic
996385411 5:122905235-122905257 GAGTGAAGTGGGAGATTGGGAGG + Intronic
996567003 5:124891113-124891135 GTGGGAGGTGGGAGTGTGGGAGG + Intergenic
996964931 5:129297006-129297028 GTGGGATGGGGGAAGGGGGGAGG - Intergenic
996984148 5:129537775-129537797 GTGGGATGGGGGAAGGGGGGAGG + Intronic
997415766 5:133727449-133727471 GTGCCCAGTGGGAAGATGGGTGG - Intergenic
997562410 5:134859948-134859970 GGCTGAGGTGGGAAGGTAGGAGG - Intergenic
997722089 5:136087422-136087444 GGGTAGAGTTGGAAGGTGGGAGG + Intergenic
997834312 5:137179904-137179926 GTGTGCAGTGGCAAGGTAGGAGG - Intronic
998103562 5:139454477-139454499 GTGTGATGTGTGAAGGTGTATGG + Intronic
998327561 5:141295070-141295092 GTGTAAAGGGGTAATGTGGGTGG + Intergenic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
998418382 5:141961732-141961754 GGGTGAAGTGGGAAGGGTGGGGG + Intronic
998494137 5:142572376-142572398 GTGTGGTGTGGGGGGGTGGGAGG + Intergenic
999588170 5:153114512-153114534 GTGTGTAGTGGGGCGGTGAGGGG + Intergenic
1000194325 5:158943043-158943065 GAGGGAAGTGGGAGGGAGGGAGG + Intronic
1000443941 5:161297152-161297174 GGCTGAAGTGGGAGGGTGGTAGG + Intronic
1001012669 5:168112594-168112616 GTGTGCAGTGGGCGGGGGGGGGG + Intronic
1001210173 5:169803681-169803703 GTGTGGAGTAGGATGGTGGTAGG + Intronic
1001589282 5:172854530-172854552 TTGGGATGTGGGTAGGTGGGTGG - Intronic
1001715949 5:173816159-173816181 GTGAGGAGTGAGATGGTGGGTGG - Intergenic
1001780110 5:174360986-174361008 GCGGGGAGGGGGAAGGTGGGGGG + Intergenic
1001823823 5:174730219-174730241 GTGTGTGGTGGGGCGGTGGGGGG - Exonic
1002400497 5:178989190-178989212 GTGGGGAGGGGGAAGGCGGGAGG - Intronic
1002426910 5:179181974-179181996 GTGTGCGGTGGGAAGCTGGAGGG - Intronic
1202772758 5_GL000208v1_random:26871-26893 GTGTGGTGGGGGGAGGTGGGAGG + Intergenic
1003359389 6:5409962-5409984 AAGTGAAGTGGGAAGGTGACTGG + Intronic
1003444244 6:6170131-6170153 GGATGAAGTGGCAAGGTGGAAGG + Intronic
1003493580 6:6644413-6644435 GGCTGAGGTGGGAAGATGGGAGG + Intronic
1003519786 6:6848393-6848415 GTTTAAGGTGGGAAGCTGGGTGG - Intergenic
1004007460 6:11650341-11650363 ATGGGAAGTGGCAAGGTTGGGGG - Intergenic
1004397284 6:15256580-15256602 GTGTGAAGTGGATGGGTGGCAGG - Intronic
1004980907 6:21022603-21022625 GTGTGAGGAGGGAAGGGGGATGG + Intronic
1005109303 6:22262061-22262083 GTGGGATGGGGGAAGGGGGGAGG - Intergenic
1005675932 6:28154855-28154877 GTGTACAGTGGGGAGGTGGAAGG - Exonic
1006639878 6:35484423-35484445 GTGTGATGAGGCAAGGAGGGTGG + Intronic
1006984156 6:38166548-38166570 GTGCGGAGGGGGAAGGTGGAGGG - Intergenic
1007170919 6:39862909-39862931 GTGCCATGTGGGAAGGTGGAAGG - Intronic
1008906656 6:56684985-56685007 GTGTGGGGTGGGGGGGTGGGTGG - Intronic
1009221355 6:60987369-60987391 GTTTGAAGTGGGATAGTGTGAGG + Intergenic
1009840436 6:69066139-69066161 GTGTGAAGGTTGGAGGTGGGGGG - Intronic
1009996224 6:70898390-70898412 GAGTGAGTTGGGGAGGTGGGGGG - Intronic
1010801098 6:80176554-80176576 GTGTGAGGTGCAAAGGTGGCAGG + Intronic
1010983816 6:82399676-82399698 GTGGGAGGGGGGAAGTTGGGGGG + Intergenic
1012448121 6:99327588-99327610 GTGTGGAGTAGGAAGATAGGAGG - Intronic
1012950164 6:105509742-105509764 GTGTGGGGTGGGGAGGTGGAAGG + Intergenic
1013306176 6:108848707-108848729 GGGCGAAGTGGGAGGGTGGCCGG + Intronic
1013805302 6:113989837-113989859 GTGTGAAGTGGGAAGACAAGAGG + Intronic
1013837091 6:114345366-114345388 AGGTGAAGTGTGGAGGTGGGTGG + Intergenic
1015579048 6:134703525-134703547 GTGAGTGGTGGGAAGGAGGGAGG + Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1016076233 6:139799371-139799393 GTGTCAAGTGGGCTGGTGGAAGG + Intergenic
1016365272 6:143309016-143309038 GTGGGGAGTGGGAGAGTGGGGGG + Intronic
1016391451 6:143579627-143579649 GTGAGACCTGGGAAGGTGAGCGG + Intronic
1016606595 6:145936136-145936158 ATGTTAAGTGGGCAGGTGGAGGG - Intronic
1017992230 6:159501065-159501087 GTGTGAAGTGGGGTGGTGGGTGG - Intergenic
1018258591 6:161947543-161947565 GTGTGAAGGAGGGAGGTGAGTGG - Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1019064835 6:169288174-169288196 CTGAGAAGTGGGAAGGGGTGAGG - Intergenic
1019361044 7:604336-604358 GTGTGGAGGGGGAAGGCTGGAGG - Intronic
1020126023 7:5532886-5532908 GGGTGTAGTGGGAAGGAGTGGGG - Intronic
1020856197 7:13427396-13427418 GAGGGAAGTGGGAAGGAGGGAGG + Intergenic
1021019189 7:15575419-15575441 GAGTGAAGTGAAAGGGTGGGAGG - Intergenic
1021340876 7:19460850-19460872 GTGGGGAGTGGGGAGGGGGGAGG + Intergenic
1022103146 7:27180934-27180956 GTGGGAAGTGGGGACCTGGGTGG - Intergenic
1022121035 7:27308271-27308293 GTGGGATGGGGGGAGGTGGGAGG - Intergenic
1022367366 7:29736355-29736377 GGGTGGGGTGGGAATGTGGGGGG + Intergenic
1022475738 7:30708356-30708378 GTGTATCTTGGGAAGGTGGGAGG - Intronic
1022886721 7:34654332-34654354 GTATGAAGCAGGAAGCTGGGGGG + Intergenic
1022991431 7:35712030-35712052 GGGGGAAGTGGGGAGGAGGGAGG + Intergenic
1023347467 7:39286130-39286152 CTGGGAAGTGGGAAGTGGGGAGG + Intronic
1023359165 7:39398478-39398500 GTCCAAAGTGGGAGGGTGGGTGG - Intronic
1024005144 7:45219806-45219828 GTGGGAAGTGAGAGGGAGGGGGG + Intergenic
1024735790 7:52302999-52303021 GGGTGCAGTGGGAAGGGTGGTGG + Intergenic
1025809534 7:64866707-64866729 GGGTGAGGAGTGAAGGTGGGTGG - Intergenic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026872231 7:73860037-73860059 GTGTGAAGTGGGAAATCAGGGGG + Intergenic
1027318268 7:76997488-76997510 GTGTGAGGTGTGGAGGTGTGTGG + Intergenic
1027839668 7:83292783-83292805 GTGGGATGGGGGAAGGGGGGAGG + Intergenic
1028113973 7:86976547-86976569 GTGTGGAGGGGGCAGGTGAGGGG - Intronic
1028651251 7:93152528-93152550 GTGGGGATTGGGAAGGGGGGGGG + Intergenic
1029123917 7:98284826-98284848 GGGTGAAGCAGGAGGGTGGGAGG - Intronic
1029595594 7:101535980-101536002 GCATGGAGTGGGCAGGTGGGCGG - Intronic
1030369906 7:108687082-108687104 GTGTGTGGTGGGTAGGTGGGAGG + Intergenic
1032259015 7:130319641-130319663 GTATGGACTGGGGAGGTGGGAGG + Intronic
1032902325 7:136323759-136323781 GTGTGTGGTGGGGTGGTGGGGGG + Intergenic
1033061780 7:138116396-138116418 GTGTGTTGAGGGAAGGTTGGTGG - Intronic
1033943235 7:146681500-146681522 GTGGGGAGTGGGAGGGTGGGAGG + Intronic
1034561149 7:151879966-151879988 GTGCGAAGTGGGATGGGGGTGGG + Intergenic
1034733195 7:153405746-153405768 GTGAGAAGAGGGGAGGTGAGGGG - Intergenic
1034938046 7:155212334-155212356 GGGTGGTGTGGGGAGGTGGGGGG + Intergenic
1035074455 7:156169015-156169037 GTGTGGGGTGGGATGCTGGGGGG + Intergenic
1035543115 8:457525-457547 ATGTAAAGCTGGAAGGTGGGGGG + Intronic
1035602134 8:902925-902947 GTGGAACGTGGGCAGGTGGGTGG + Intergenic
1035741143 8:1929665-1929687 GAGAGAAGTGGGAGGGTGGGAGG - Intronic
1036465240 8:8991333-8991355 GTGTGAAATGGGGAGGTGTCTGG + Intergenic
1036500279 8:9307941-9307963 GTATGCAGTGGGGAGATGGGTGG + Intergenic
1036638205 8:10565609-10565631 GTGTGTCGGGGGCAGGTGGGAGG - Intergenic
1037157917 8:15728447-15728469 GTGTGGAGAGGGAGGGAGGGAGG + Intronic
1037449589 8:19003422-19003444 GTGAGAAGTGTGAAGTTGGGAGG - Intronic
1037472712 8:19226024-19226046 GTGTGAGCTGGCAAGGTTGGAGG - Intergenic
1037776240 8:21837806-21837828 GTGGGCAGAGGGAAGGAGGGAGG - Intergenic
1037917051 8:22779049-22779071 GTAGGTGGTGGGAAGGTGGGCGG + Intronic
1038533820 8:28339584-28339606 GTGTGGAGTGGGGAGGGGGCGGG - Intronic
1038905554 8:31898066-31898088 ATTTGAAGTGGCAAGGTGTGAGG - Intronic
1039635475 8:39159887-39159909 GTGTGAGATGGGATGGTAGGTGG + Intronic
1039892409 8:41694423-41694445 GAGTTAAGTGGGAAGGGGTGAGG - Intronic
1040334438 8:46408890-46408912 GAGTGAAGTGGGCGGGTGGCAGG + Intergenic
1040871979 8:52109294-52109316 GTGAGAAGTGAGAAGATGAGAGG - Intergenic
1040954638 8:52967389-52967411 ATGTGAAGGTGGAGGGTGGGAGG - Intergenic
1041192301 8:55366155-55366177 GTGGGAGGTTGGAAGGTAGGAGG - Intronic
1041205881 8:55497846-55497868 GTGTGAGGTGGGAAGGTATTAGG - Intronic
1041608973 8:59821174-59821196 GTGTGAAGAGGTAGGGTGTGGGG + Intergenic
1041620304 8:59959904-59959926 GTGTGAATTGGGTAGGAGGTGGG + Intergenic
1041924553 8:63222935-63222957 GTGTGTAGTGTACAGGTGGGTGG + Intergenic
1042794613 8:72647683-72647705 GTGGGAAGTGGGAATGAGGCTGG + Intronic
1043780440 8:84327383-84327405 GTCTGCAGAGGGAATGTGGGAGG + Intronic
1044452887 8:92359103-92359125 GGAAGAAGTGGGAGGGTGGGTGG - Intergenic
1044948446 8:97413232-97413254 GTGTGATGAGGGGAGCTGGGAGG - Intergenic
1045252485 8:100493463-100493485 GTGTGAAGAGGGAGGAGGGGAGG + Intergenic
1045709548 8:104966998-104967020 GTGTGAGTGGGGAAAGTGGGAGG - Intronic
1045803941 8:106134977-106134999 GTGTTGAGTGAGGAGGTGGGAGG + Intergenic
1045914952 8:107457809-107457831 GTGTGTAGTGGGTATGTGTGGGG - Intronic
1046683463 8:117197413-117197435 GTGGGATGGGGGAAGGGGGGAGG + Intergenic
1046962388 8:120125029-120125051 GCGGGAGGTGGGGAGGTGGGAGG - Intronic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047800458 8:128304267-128304289 GGGTGGAGTGGGGAGATGGGAGG - Intergenic
1048501917 8:134985757-134985779 CTGTAAAGTGTTAAGGTGGGAGG - Intergenic
1048600572 8:135915172-135915194 GTTTGAAGGTGGAGGGTGGGAGG + Intergenic
1048922220 8:139241617-139241639 ATGTGAGTTGTGAAGGTGGGAGG + Intergenic
1049074958 8:140388227-140388249 GTGGGGAGGGGGGAGGTGGGAGG + Intronic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049434315 8:142579427-142579449 GTGGGACCTGGGAAGGAGGGAGG + Intergenic
1049479019 8:142811196-142811218 GTGTGAATTGGGCAGGGAGGTGG - Intergenic
1050804007 9:9651389-9651411 TTTGGAAGTTGGAAGGTGGGAGG - Intronic
1051743096 9:20270034-20270056 GTGTGAAGAGGGAAGACTGGAGG + Intergenic
1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG + Intergenic
1052081790 9:24214934-24214956 GTGGGGAGGGGGAAGGGGGGAGG + Intergenic
1052150956 9:25115126-25115148 GAGTAAAGTGGCAAGGTGGGAGG - Intergenic
1053180049 9:35960977-35960999 GAGAGAAGCGGGGAGGTGGGAGG + Intergenic
1053288071 9:36862647-36862669 GTCTGAAGCAGGTAGGTGGGCGG + Intronic
1055292966 9:74802969-74802991 GGTTGAACTTGGAAGGTGGGTGG - Intronic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055588477 9:77783610-77783632 CTGAGCAGTGGGAAGGTAGGTGG - Intronic
1055639906 9:78311375-78311397 TTCAGAAGTGAGAAGGTGGGAGG + Intronic
1055758602 9:79582121-79582143 TTTTGAAGGGGGAAGCTGGGAGG + Intronic
1055913226 9:81374601-81374623 CTGCTGAGTGGGAAGGTGGGAGG - Intergenic
1056004327 9:82251096-82251118 TTGTCAAGTGAGAAGGTGGGTGG - Intergenic
1056690496 9:88804197-88804219 GTGAGCGGTGGGAAGTTGGGAGG + Intergenic
1057117709 9:92541401-92541423 GTGGGGAGGGGGAAGGGGGGTGG - Intronic
1057516377 9:95725325-95725347 GTATGGAGTGGGAAGGGGTGAGG + Intergenic
1057824260 9:98360096-98360118 GTCTGAAGTAGGTAAGTGGGAGG + Intronic
1057901791 9:98954906-98954928 GAGTGGAGAGGGAGGGTGGGAGG - Intronic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058410430 9:104725177-104725199 GTGTGGAGAGGGATGGTTGGTGG - Intergenic
1058779842 9:108321924-108321946 GTGTGAGGTGGGATGGTTGTTGG - Intergenic
1058971365 9:110086158-110086180 CTGAGAAGTGGGAGGGTGTGGGG + Intronic
1059208486 9:112487482-112487504 GTCGGAGGTGGGAAGGAGGGCGG + Intronic
1060190330 9:121588549-121588571 GGGTGAAGGGGGAAGGGGGAAGG + Intronic
1060404674 9:123367432-123367454 GTGTGGGGTGGGGGGGTGGGGGG - Intronic
1061478252 9:130883609-130883631 GAGTGATGTGGGTGGGTGGGGGG - Intronic
1061500053 9:130996986-130997008 GTGCCAAGCGGGGAGGTGGGAGG - Intergenic
1062108551 9:134768970-134768992 GTGTGGAGGGGGGAGGTGTGAGG + Intronic
1062180582 9:135189172-135189194 GTGTGATGTGGCTTGGTGGGGGG - Intergenic
1062180645 9:135189360-135189382 GTGTGGTGTGGCATGGTGGGGGG - Intergenic
1062180720 9:135189594-135189616 GTGTGATGTGGCATGGTGGAGGG - Intergenic
1062267975 9:135696068-135696090 GTGGGAAGTGGGGAGGTAGAGGG - Intronic
1062514950 9:136928389-136928411 GTGGGAAGTGGGTTGGTGGGTGG + Intronic
1203755461 Un_GL000218v1:121541-121563 GTGTGAAGTGGGAAATCGGGGGG + Intergenic
1203545267 Un_KI270743v1:123547-123569 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
1185843942 X:3419533-3419555 GCTTGAAGGGGGAGGGTGGGAGG - Intergenic
1185891142 X:3823164-3823186 GTGTGTAGTGTGATGGTGTGTGG + Intronic
1185896246 X:3861580-3861602 GTGTGTAGTGTGATGGTGTGTGG + Intergenic
1185901365 X:3900006-3900028 GTGTGTAGTGTGATGGTGTGTGG + Intergenic
1186356887 X:8799788-8799810 GTGTGCAGTGGGGAGGGGTGGGG - Intronic
1186357213 X:8800903-8800925 GTGTGCAGTGGGTAGGGGTGGGG - Intronic
1186497318 X:10021924-10021946 GTGTGGATTGGGCAGCTGGGTGG - Intronic
1187716154 X:22104436-22104458 GTTTGAGGTGGAAAGGGGGGTGG + Intronic
1190074938 X:47310007-47310029 ATGTGGAGTTGGGAGGTGGGAGG + Intergenic
1190910168 X:54764401-54764423 GTGGGGAGGGGGAAGGGGGGAGG - Intronic
1191592323 X:62901420-62901442 TTGTGAGGTGGGGAGGGGGGAGG - Intergenic
1192233460 X:69281434-69281456 GTGTGTGGTGGGAAGGTGAAAGG - Intergenic
1192237987 X:69308019-69308041 GGCTGAAGTGGGCGGGTGGGGGG + Intergenic
1192879448 X:75267425-75267447 GTGGGGTGTGTGAAGGTGGGAGG + Intergenic
1193135684 X:77968790-77968812 GTGTGACATGTGCAGGTGGGAGG + Intronic
1193679631 X:84502297-84502319 GTGAGAAGGGCGAAGGAGGGAGG - Intronic
1193992353 X:88323605-88323627 ATCAGAAGAGGGAAGGTGGGAGG - Intergenic
1194544625 X:95217934-95217956 GTGGGCAGTGGGCAGGAGGGAGG + Intergenic
1195099346 X:101539387-101539409 GGGTGAGGTGGGCAGGTAGGTGG - Intergenic
1195122147 X:101765586-101765608 GGGTCAAGTGGGATGGTGGAGGG + Intergenic
1196029953 X:111086103-111086125 GTGTGCACTGGGCAGGGGGGCGG + Intronic
1196181316 X:112693611-112693633 GTTTGGAGTGGGGAGTTGGGAGG - Intergenic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1196753670 X:119139362-119139384 CAGGAAAGTGGGAAGGTGGGAGG + Intronic
1197683897 X:129417543-129417565 CTCTGAAGTGGAAAGGAGGGAGG + Intergenic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198410606 X:136363253-136363275 GTGGGAAGGGGGAAGGGGAGTGG - Intronic
1198784780 X:140274855-140274877 GTGTTAAGTAGTGAGGTGGGTGG - Intergenic
1199641295 X:149864780-149864802 ATTTGAAGTTGGAGGGTGGGAGG + Intergenic
1199754707 X:150853391-150853413 CAGTGAAGTGGGTGGGTGGGGGG - Intronic
1199928104 X:152490725-152490747 GTGGGGAGTGGGGAGGGGGGAGG + Intergenic
1200731558 Y:6748419-6748441 GACTCAAGGGGGAAGGTGGGAGG - Intergenic
1201169077 Y:11239147-11239169 GTGTGAAGTGGGAAATCGGGGGG + Intergenic
1201256346 Y:12111996-12112018 GAGGGAAGGGGGAAGGAGGGAGG - Intergenic
1201438541 Y:13985329-13985351 GTGTGGGGTGGGAGGGAGGGAGG - Intergenic
1201446032 Y:14057379-14057401 GTGTGGGGTGGGAGGGAGGGAGG + Intergenic
1201529000 Y:14971289-14971311 GTGGGAAGAGGGGAGGGGGGAGG - Intergenic
1201702555 Y:16900472-16900494 GAGGGAAATGGGAAGGAGGGAGG - Intergenic
1201904418 Y:19075617-19075639 GTGTCATTTGGGAAGGTCGGTGG - Intergenic