ID: 911392049

View in Genome Browser
Species Human (GRCh38)
Location 1:97257765-97257787
Sequence GCAGCTATTATGTTTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911392049 Original CRISPR GCAGCTATTATGTTTGGAGC TGG Intronic
903026590 1:20433815-20433837 GCATTTCTTATGGTTGGAGCAGG - Intergenic
905296308 1:36956511-36956533 GCAGCTGTTTTCTTGGGAGCTGG - Intronic
908234810 1:62138768-62138790 GCAGATCTTAGGATTGGAGCTGG + Intronic
909184237 1:72465505-72465527 GCAGTAATAATGTTTGGAGTTGG - Intergenic
909579360 1:77216659-77216681 GCAGCTGTTGAGTTTGGAGGGGG - Intronic
911392049 1:97257765-97257787 GCAGCTATTATGTTTGGAGCTGG + Intronic
911753131 1:101521767-101521789 GCAGCTCTTATCTTTGCAGCAGG + Intergenic
921416725 1:214897416-214897438 GCATCTATTGATTTTGGAGCTGG + Intergenic
922006811 1:221539479-221539501 GCAGATTTTATGTCTGGAGACGG - Intergenic
922369946 1:224899924-224899946 TCAGATACTATGTTTGGTGCTGG + Intronic
1064360353 10:14658799-14658821 GCATTCATTATGTTTGCAGCAGG + Intronic
1065669677 10:28102774-28102796 GCAGATATTATCTGTGGAGGTGG - Intronic
1065774311 10:29105197-29105219 GAATCCAGTATGTTTGGAGCTGG + Intergenic
1069583068 10:69578261-69578283 CCAGGTATTATGTTGGGAGAAGG - Intergenic
1070069054 10:73067917-73067939 CCAGCTATTATGTTAGGTACTGG - Intronic
1070896364 10:79985960-79985982 GCAGCTATCATGTTGTGAGGAGG - Intergenic
1070996504 10:80788269-80788291 TCAACTATTAAGTTTGGAGGTGG + Intergenic
1074494106 10:113964047-113964069 GTAGCTATTTTGTCTGAAGCTGG - Intergenic
1075164319 10:120053270-120053292 AAAGCTATTATCTGTGGAGCAGG + Intergenic
1078056208 11:8010960-8010982 GGAGCTTTTAGGTTTGGAGCTGG - Intergenic
1079326734 11:19499398-19499420 GCAGGTATTCTGTTTGCAGTTGG + Intronic
1081860805 11:46332590-46332612 GCAGCTGGCAGGTTTGGAGCGGG - Intergenic
1083862768 11:65432987-65433009 GCAGCAATTTTGGATGGAGCTGG - Intergenic
1085191246 11:74625305-74625327 CCAGGTAATATGTTAGGAGCAGG - Intronic
1085879396 11:80448121-80448143 ACAACAAGTATGTTTGGAGCAGG - Intergenic
1088919922 11:114253276-114253298 TCAGCTTTTATGAATGGAGCGGG - Intergenic
1090330239 11:125925755-125925777 GCTGCTATGATGTTAGGTGCTGG + Intergenic
1093061916 12:14616355-14616377 GTAGCTCTTGTGTTTGGAGGAGG + Intronic
1093798391 12:23341357-23341379 GCAGCCATTCTGATTGGTGCTGG - Intergenic
1095303471 12:40614071-40614093 GCAGCTATGCTGTGTGGAGGGGG + Intergenic
1097256185 12:57676395-57676417 GCAGCTACCACCTTTGGAGCTGG + Intergenic
1097909512 12:64954668-64954690 GCTGCTATTATGTCTTGAGAAGG - Intergenic
1099301958 12:80907323-80907345 ACAGCTATGATGTTTGGAATGGG + Intronic
1099969938 12:89490160-89490182 GTAGCTGGTATGTTTGGAGTGGG - Intronic
1100132496 12:91513487-91513509 GCTGCTCTTCTGCTTGGAGCTGG - Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1101937502 12:109070059-109070081 GCTTCTATTGTGTTTGCAGCGGG + Intronic
1103967826 12:124651439-124651461 GAAGCTATTAAGTTTTAAGCAGG - Intergenic
1104098340 12:125582240-125582262 TTAGCTATTATGTATGGAACAGG - Intronic
1105891559 13:24685872-24685894 GAAGCTAGTATGTGTGGAGAGGG + Intronic
1110101188 13:71605955-71605977 GCAGCTATCATGTGTTGAACTGG + Intronic
1110380212 13:74841650-74841672 GCAACTATTATGTATGTACCAGG - Intergenic
1111261628 13:85748023-85748045 GCAGATTTTATGTTTGGTGAGGG + Intergenic
1112930753 13:104733259-104733281 TGAACTATTTTGTTTGGAGCTGG + Intergenic
1114255649 14:20999384-20999406 GGAGCTGTAATCTTTGGAGCAGG - Exonic
1120535330 14:85688385-85688407 TCTGCTATTATGTCTGCAGCAGG - Intergenic
1128699497 15:69794022-69794044 TCAGCTGTGCTGTTTGGAGCTGG + Intergenic
1129360308 15:75020210-75020232 GTAGCTGTTCTGTTTGGATCTGG + Exonic
1138852899 16:60651503-60651525 GCAACTGTAATGTTTGAAGCGGG - Intergenic
1140297112 16:73719495-73719517 TCAGCTACTATTTTGGGAGCAGG - Intergenic
1143169493 17:4919533-4919555 GAAGCTATCATGGTTGTAGCGGG + Intergenic
1148968680 17:51460091-51460113 GCAGCTATAATGTTTGTTGCAGG + Intergenic
1151364825 17:73610343-73610365 GCAGCTTTTGAGCTTGGAGCAGG - Intronic
1156136631 18:34047888-34047910 ATAGCTATTCTGTTTGGTGCTGG - Intronic
1156895976 18:42246029-42246051 TCAGATGCTATGTTTGGAGCTGG + Intergenic
1158045051 18:53145659-53145681 GCAGCTATTACTTTTAGAACTGG + Intronic
1159018516 18:63122927-63122949 GCAGCTACTTGCTTTGGAGCAGG - Intergenic
1163494700 19:17639517-17639539 GAAGTTATTCTGTTGGGAGCAGG + Exonic
1167198931 19:48050512-48050534 GCTGCTGTTAAGTTTTGAGCAGG - Intronic
1168415097 19:56162718-56162740 GCAGCTGTGCTGTTAGGAGCTGG - Intergenic
926391289 2:12396174-12396196 GCAGCCAGTATGTTTGGGGCAGG - Intergenic
926589271 2:14722411-14722433 GAAATTATTATGTTTGAAGCAGG - Intergenic
930591281 2:53329181-53329203 GCAGATATTCTTTGTGGAGCTGG - Intergenic
936666291 2:114599795-114599817 TCAGCTTTTATGTTTAGAGCGGG + Intronic
938865774 2:135418552-135418574 GGAGCTATTAAGTTTGGATCTGG + Intronic
940779357 2:157916729-157916751 GCAAGTATTATAATTGGAGCTGG - Intronic
945165710 2:206941709-206941731 GCAGCTAACATGTTTTGAGTTGG - Intronic
1178251544 21:31008172-31008194 GTAGCTATTATGATTGAATCAGG - Intergenic
1179434167 21:41348810-41348832 ACAACTCTTATGTTTGGAGACGG - Intronic
1183212345 22:36458653-36458675 GAAGCTAGCAAGTTTGGAGCAGG - Intergenic
956454802 3:69409937-69409959 GCAGCTCTTATGGTTTAAGCTGG + Intronic
958826877 3:99041225-99041247 CCAGCTCTTCTGTGTGGAGCAGG - Intergenic
962953691 3:140244587-140244609 GCAGCTATTATGTATGTGCCAGG - Intronic
964477266 3:157108314-157108336 GCACCTAACATGTTTTGAGCTGG - Intergenic
965120319 3:164546220-164546242 TCAGCTATTATTTTTGGTACAGG - Intergenic
966433647 3:179859577-179859599 GCAGCTTTTATGTTTTTAACCGG - Intronic
967835732 3:193960818-193960840 GGAGCTAGTATGTATGGAGCAGG + Intergenic
973324063 4:48839491-48839513 ACAGCTACTGTGTGTGGAGCTGG - Intronic
978134723 4:105243596-105243618 GAAGCTACTGTGTTTGGTGCGGG + Exonic
978382505 4:108144349-108144371 ACAGTTCTTATATTTGGAGCTGG + Intronic
979073895 4:116245667-116245689 TCATTTATTATGTTTGTAGCTGG + Intergenic
980137299 4:128871074-128871096 TCAGTTATTTTGTTTGGAGGAGG + Intronic
980887465 4:138779027-138779049 ACAGCTACTATGTTTGGGGATGG - Intergenic
981020958 4:140028078-140028100 GCAAGTATTATGTTTGGAATAGG + Intronic
983120824 4:163882452-163882474 GCAGCTATGATATTAGGAGAGGG + Intronic
983855563 4:172639742-172639764 GTAGATATTATGGTGGGAGCTGG - Intronic
987252151 5:16111016-16111038 GCAGGTCTTATGTTGGCAGCAGG - Intronic
987264710 5:16241123-16241145 ACAGATATTATGACTGGAGCAGG - Intergenic
987622314 5:20351135-20351157 ACATTTACTATGTTTGGAGCAGG - Intronic
996394372 5:122998436-122998458 GCATCTATTATGTTAGGCACTGG - Intronic
999425216 5:151482162-151482184 GAAGCTACTCTGTTTGGACCTGG - Intronic
1001526348 5:172431293-172431315 GCAGCTCTTCTGGATGGAGCTGG - Intronic
1005967670 6:30739314-30739336 GCTGATCATATGTTTGGAGCAGG - Intronic
1006078356 6:31548780-31548802 GTAGCTATGAAGTGTGGAGCTGG - Intronic
1006695809 6:35929650-35929672 GCAGGTACTGTGTTTGGTGCTGG + Intergenic
1011098745 6:83697303-83697325 GCAGCTATTTTCTTTAGAGTTGG - Intronic
1016257425 6:142124616-142124638 ACAGCTATTATTTTTGGCGGGGG - Intergenic
1019995044 7:4718530-4718552 GCAGCTATTGTATTTGTAGTAGG - Intronic
1020193707 7:6020441-6020463 GCAGCTTTTATGTGGGGTGCAGG + Intronic
1021588111 7:22231775-22231797 GCAGCTATTATGTCCATAGCAGG + Intronic
1021957961 7:25845241-25845263 GCAGCTATTCTGCTTGCAGAGGG - Intergenic
1024886542 7:54148526-54148548 GCAGCTCTTATGTCAGGAACTGG + Intergenic
1029052750 7:97706455-97706477 GCAACTATTAAGTTTTGAGAGGG - Intergenic
1030008274 7:105139856-105139878 ACAGTTATTAAGTTTTGAGCTGG + Intronic
1030138248 7:106280065-106280087 GAAGCCATTATGTTTTAAGCTGG + Intronic
1030738180 7:113075948-113075970 GCAGCTATTATGTTAGAAGTTGG + Intergenic
1030816854 7:114049423-114049445 GCACCAAATATGTTAGGAGCAGG - Intronic
1031258285 7:119484062-119484084 GCATCTATTATGGTTGGAATTGG + Intergenic
1036026276 8:4912781-4912803 CCAGCTATTTTTTTTGGAGGGGG + Intronic
1036556798 8:9867241-9867263 GCAGCTGTTATGAATGAAGCTGG - Intergenic
1038995597 8:32919679-32919701 GAAGGTTTTATATTTGGAGCTGG + Intergenic
1042864939 8:73348929-73348951 ACGGCTAGTAAGTTTGGAGCTGG + Intergenic
1044651966 8:94505227-94505249 GCAGGTACTGTGTTTGGTGCTGG - Intronic
1046705403 8:117444449-117444471 ACAGCTTTTGTGTTTGGAGAAGG + Intergenic
1047654611 8:126963505-126963527 GCTGCTAGTAAGTGTGGAGCGGG + Intergenic
1047872619 8:129101692-129101714 GCAGCTTTTGTTTTTGGAGCTGG - Intergenic
1055172884 9:73282126-73282148 ACAACTAGTATGTTTGGAGTGGG + Intergenic
1056099905 9:83291393-83291415 GCAGCTAGTATCTCTGCAGCAGG - Intronic
1058043639 9:100332896-100332918 GCAGCTTTTTTCTTTGGAACTGG - Intronic
1059393018 9:114011114-114011136 GCAGCTATTAAGTGTCGAGCTGG - Intronic
1187985250 X:24803076-24803098 CCAGTTATCATGTTTGGAGCTGG + Intronic
1191733405 X:64363452-64363474 GCATCTCACATGTTTGGAGCAGG - Intronic