ID: 911393638

View in Genome Browser
Species Human (GRCh38)
Location 1:97277658-97277680
Sequence TGTAGTAGCAATGGAGGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911393638 Original CRISPR TGTAGTAGCAATGGAGGAAT TGG (reversed) Intronic
903330114 1:22592962-22592984 TGTAGAAAGAATGGAGGAACTGG - Intronic
903866725 1:26404188-26404210 TGTAATAGGAATGGGGGAATGGG + Intergenic
903993019 1:27287648-27287670 TATAGGAGAAATGGAGGAAGGGG - Intronic
906771204 1:48486387-48486409 TGTAGTTGCAATGGAAGCAGAGG + Intergenic
906778463 1:48550937-48550959 TGCAATAGCAGTGGAGGAAGAGG - Intronic
907618235 1:55947376-55947398 TGTTGTAGTAAAAGAGGAATTGG - Intergenic
909145094 1:71920085-71920107 TGTAGAAGCAATGGGGAAAATGG - Intronic
909547877 1:76867952-76867974 TGCAGGAGCGATGGAGGAGTGGG + Intronic
910004167 1:82374968-82374990 TGTACTAGCAATGAATGATTAGG - Intergenic
910172900 1:84397209-84397231 AATAATACCAATGGAGGAATGGG + Intergenic
911393638 1:97277658-97277680 TGTAGTAGCAATGGAGGAATTGG - Intronic
912039515 1:105370398-105370420 TGTTGTAGCAGTGTAAGAATGGG - Intergenic
912470587 1:109904369-109904391 TGTAGAAGGAATGCAGGATTTGG - Intergenic
912987323 1:114447010-114447032 TGTAGCAGAGATGGAGGGATAGG + Intronic
913271392 1:117096994-117097016 TATTGTAGCAATGGAGGGGTAGG + Intronic
915825191 1:159068184-159068206 TGTAGTTGCAATAGAGGCCTTGG - Intronic
917512033 1:175676674-175676696 TGTAGAAGGAAGGGAGAAATAGG - Intronic
918192796 1:182192238-182192260 TGGAATAGCAATGGAGGAAATGG + Intergenic
918638855 1:186813756-186813778 TGTTGTAGCAAAGAAGGAAAGGG - Intergenic
919679706 1:200422156-200422178 TCTAGTAGCAATGAAGGAGGTGG + Intergenic
920518444 1:206604112-206604134 TGTACCAGCAAAGGAGGACTTGG + Intronic
1063009686 10:2010255-2010277 TGTAATAGCAATTAAGAAATAGG - Intergenic
1063205229 10:3825108-3825130 TCTAGTAGAAATGGAGGATGAGG + Intergenic
1063833900 10:9989554-9989576 TGAAAAAGGAATGGAGGAATAGG + Intergenic
1068700118 10:60010611-60010633 TGTAGCAGAGATGGAGGAATCGG - Intergenic
1068766979 10:60775033-60775055 TCCAGTAGCAATGGAGGCCTTGG + Intergenic
1072549949 10:96469669-96469691 TCTGGGAGCACTGGAGGAATGGG - Intronic
1073946595 10:108757767-108757789 TGCAGTAGCAATGGGGCAAATGG + Intergenic
1074228587 10:111511984-111512006 TGTAGCAGAAATGAGGGAATAGG + Intergenic
1076224659 10:128764499-128764521 TGTGGTAACAATGGGGGAAGAGG + Intergenic
1078177410 11:8980454-8980476 GCCAGTAGCAATGGAGGAACAGG + Intergenic
1078351045 11:10593723-10593745 TGCAGTAGCAATGATAGAATTGG + Intronic
1079927513 11:26513158-26513180 GGTAGTAGCAGAGGAGGTATGGG + Intronic
1082831855 11:57624222-57624244 TGTAGCAGCAGAGTAGGAATCGG - Intergenic
1084938622 11:72600682-72600704 GGTAGTAGTAAGGGAGGAACTGG - Intronic
1087554400 11:99696549-99696571 TGTAATATTTATGGAGGAATTGG + Intronic
1089142875 11:116301531-116301553 TGTAGCATCAGTGGAGGTATTGG - Intergenic
1089270238 11:117296883-117296905 GGTAGTAGCGATGCAGGAAGGGG + Exonic
1089417023 11:118300714-118300736 TGTAGTAGCTATGGTGGCAATGG + Intergenic
1093872012 12:24304322-24304344 TGAAGTAGAAATGGAAGATTGGG + Intergenic
1095806998 12:46330554-46330576 TGTAGTAGCCTAGGAGCAATAGG - Intergenic
1096865982 12:54563242-54563264 TGCAGAAGCTATGGTGGAATGGG + Intronic
1099004896 12:77224481-77224503 TGTAGGGGCAATGGAGGGAGTGG - Intergenic
1101187507 12:102294577-102294599 TGGAGAAGATATGGAGGAATCGG - Intergenic
1102838041 12:116085676-116085698 TTTAGGAGTAATGTAGGAATGGG + Intronic
1106384765 13:29273385-29273407 TGTAGTCACAATGCAGGGATAGG + Intronic
1107509129 13:41064089-41064111 TGTAGAAACAATGGAAGGATAGG - Intronic
1108774841 13:53753036-53753058 GGTAGGAGGAAGGGAGGAATAGG - Intergenic
1108941428 13:55960641-55960663 AGTAGTACTAATGGAGGAGTTGG + Intergenic
1109208090 13:59504109-59504131 TGTAGCAGAGAGGGAGGAATAGG - Intergenic
1110023517 13:70506856-70506878 GGTAGTAGAAATTGATGAATGGG + Intergenic
1111570624 13:90079913-90079935 TGCAAGAGCACTGGAGGAATCGG - Intergenic
1116543608 14:46134255-46134277 TGAAGTAGCTATGGAGTTATGGG + Intergenic
1131705888 15:94995616-94995638 TGTACTACAAATGGAGAAATTGG + Intergenic
1131717494 15:95129335-95129357 TTTAGAAGCAATAGAGCAATAGG - Intergenic
1131768034 15:95701489-95701511 TGTAGAAGCAATGTTGGAACTGG - Intergenic
1132252719 15:100346307-100346329 TGTAGTAGCAATGGTGGGCATGG - Intergenic
1135897016 16:26415772-26415794 AGTAGTAACAATGGATTAATGGG + Intergenic
1138024487 16:53511955-53511977 GGTAGTAGCAGTGGAGGTGTGGG - Intergenic
1141151881 16:81570072-81570094 TGGAGTATCAATGGGGGAAGGGG + Intronic
1142179175 16:88658957-88658979 AGTAGAAGCGATGAAGGAATGGG - Intronic
1146191928 17:30776324-30776346 TGAAGTAGCCATGCAGGAAATGG + Intronic
1146323994 17:31869809-31869831 GGTAGGAGGAATGGAGGAAAGGG - Intronic
1146337103 17:31983026-31983048 TGAAGTAGCCATGCAGGAAATGG + Exonic
1146407491 17:32551970-32551992 TTTGGTAGCAGTGGAGGGATAGG - Intronic
1151229168 17:72670489-72670511 TGTAGAAGGAAGGGAGGAAATGG - Intronic
1155633206 18:27919941-27919963 TGTGGTATCAATGGAGAAAGGGG + Intergenic
1155640523 18:28008349-28008371 TTTAATATCATTGGAGGAATAGG - Intronic
1158110161 18:53931906-53931928 TATCATAGCAATGGAGGAAATGG + Intergenic
1158268040 18:55681787-55681809 GGTGGTAGTAAAGGAGGAATTGG + Intergenic
1158785155 18:60702691-60702713 TGTAGTGGCAGGGGAGAAATGGG + Intergenic
1159976486 18:74719319-74719341 CGTAGGAGGAAGGGAGGAATAGG - Intronic
1160326758 18:77957364-77957386 GGTATTAGCAATGGTGGTATTGG - Intergenic
1165458833 19:35931957-35931979 GGTAGTAGTAATGAAGAAATTGG + Intergenic
928798323 2:35053494-35053516 AGTAGTAGCAGTGGTGGACTGGG + Intergenic
930331557 2:49991870-49991892 TGTGGTATTAATGAAGGAATAGG + Intronic
932210970 2:69929870-69929892 TGTAGTACTAATACAGGAATAGG - Intronic
933896564 2:86815660-86815682 TGTAGTATCCATGCAGGCATTGG + Exonic
936768456 2:115882819-115882841 TGTCATAGCAATGGAGTAACTGG - Intergenic
938031668 2:127999766-127999788 AGCAGTAGCATGGGAGGAATGGG + Exonic
938918759 2:135972555-135972577 TGAAGTAGAAATGGACAAATGGG + Intronic
939207188 2:139122242-139122264 AGGAGTGGAAATGGAGGAATAGG - Intergenic
939696445 2:145331035-145331057 CGTACTAGCAAAGGAGGAACAGG - Intergenic
941156943 2:161990859-161990881 TGTGGTTCCAATGGAGGAGTGGG + Intergenic
941532954 2:166691959-166691981 AGTAGTAGCAATGAAGCACTTGG - Intergenic
942931802 2:181502655-181502677 TGGAGTAGGGATGGAGGAAGTGG + Intronic
943036305 2:182750236-182750258 TGTGGTAGCAATGTAGAAAATGG + Intronic
945871437 2:215231016-215231038 TGTGATAGCAATGAAGGAAAAGG - Intergenic
947243182 2:228018370-228018392 TGTTGTAGCAGTTGAAGAATCGG + Exonic
947863704 2:233380966-233380988 GGTAGTGGCAATGGGGAAATTGG + Intronic
1169576410 20:6966738-6966760 TACAGGGGCAATGGAGGAATTGG + Intergenic
1169666308 20:8040513-8040535 TGTAGAAGGAATGAAGGAAATGG - Intergenic
1170722060 20:18890309-18890331 TGTGGCAGCAATGGAGGCAAAGG - Intergenic
1171128658 20:22627746-22627768 TGTTCTAGCCCTGGAGGAATTGG - Intergenic
1172531156 20:35632183-35632205 TGTAGTAACCATGGAGGTAGAGG - Exonic
1174129351 20:48330998-48331020 TTTAGTAGACATGGAGGCATGGG + Intergenic
1174742396 20:53028004-53028026 TGTGGTTGCATTGGAGGAAATGG + Intronic
1175652348 20:60736264-60736286 TGCAGGAGCAATGGAGGAACAGG - Intergenic
1176098779 20:63355793-63355815 AGCAGGAGCAATGGAGAAATTGG - Intronic
1176661058 21:9635180-9635202 AGCAGAAGCAATGGTGGAATAGG + Intergenic
1177621243 21:23597409-23597431 TATAGCAGCAATGAAGAAATGGG + Intergenic
1182022779 22:27095019-27095041 TGTAAAAGCAATGAATGAATGGG + Intergenic
1182980224 22:34662882-34662904 GATAGTAGCTATGGTGGAATGGG + Intergenic
949296128 3:2525928-2525950 TGTAGTAGCAATGGGGGTGGAGG - Intronic
949635445 3:5976890-5976912 TGAAGTAGCACTGTGGGAATGGG - Intergenic
950026069 3:9820709-9820731 GGTAGTAGCGCTGGAGGAAGAGG - Exonic
952990152 3:38824524-38824546 TGAAGTAGAAAGGGAGGAAGGGG + Intergenic
956100994 3:65767993-65768015 TTTAGTAGCAATTCATGAATTGG - Intronic
961963289 3:130875269-130875291 TGTAGTTGGAGGGGAGGAATAGG - Intronic
962849765 3:139299591-139299613 AGCAGTAGCCAAGGAGGAATTGG - Intronic
963093683 3:141511867-141511889 TGAGGTAGCACTGGTGGAATGGG + Intronic
963677461 3:148330544-148330566 TTTAGCAGCAAGGGAGGAAATGG - Intergenic
964936237 3:162091822-162091844 TGTATGAACAATGGAGCAATTGG - Intergenic
966022429 3:175231919-175231941 TGCAATAGCAATGGAGAAAGGGG + Intronic
970236515 4:13964238-13964260 TGGAGTAGAAAAGGAGGTATAGG + Intergenic
972063740 4:34912274-34912296 TATAGTAGCAATGTACCAATTGG - Intergenic
972744317 4:41918455-41918477 TGTTGAAGAGATGGAGGAATTGG + Intergenic
975765961 4:77667868-77667890 TGTGGTAGAAATGGAAGAACAGG - Intergenic
976237751 4:82917550-82917572 GTTAGTAGCACTGGAGGAACAGG + Exonic
976489112 4:85647035-85647057 TCTAGTTGGAATTGAGGAATTGG + Intronic
978076345 4:104535126-104535148 TGTAGAAGAGATGGAGGGATTGG - Intergenic
978246901 4:106583766-106583788 TGTAGTAGCAAAGAAGGAAATGG + Intergenic
979655862 4:123192751-123192773 TGAAGAAGCTATTGAGGAATAGG - Intronic
979977102 4:127210369-127210391 TGTACTAGAAATGGAGTACTAGG - Intergenic
980928204 4:139159460-139159482 TGAAGTTTCAATGGAGGAGTAGG + Intronic
984394912 4:179185132-179185154 TGAAGTAGGAATGGAGAAAGAGG + Intergenic
985343729 4:188978479-188978501 AGTAGAAACAGTGGAGGAATTGG + Intergenic
985414341 4:189721356-189721378 AGCAGAAGCAATGGTGGAATAGG - Intergenic
987958735 5:24775054-24775076 TGAAGTAACAATGGAAAAATGGG + Intergenic
990756967 5:59083431-59083453 TGTGGTAGAAGTGGAGGAATGGG - Intronic
991173789 5:63660852-63660874 TGTAGAAGGAATAGTGGAATGGG + Intergenic
991177632 5:63708436-63708458 TATAGTAGGGATGGAGGGATGGG + Intergenic
993887463 5:93432649-93432671 AGTAGTTGGAATGGAGAAATAGG - Intergenic
995880432 5:116838899-116838921 TGTAGTATTTATGAAGGAATAGG + Intergenic
996705865 5:126497811-126497833 TGAAGGAGCAAAGGAGTAATAGG - Intergenic
998139437 5:139691538-139691560 TGTTGAATCAATGGATGAATTGG + Intergenic
998407895 5:141884136-141884158 AGTACTAGGAGTGGAGGAATGGG - Intergenic
1002809120 6:609088-609110 GGTAGTAGCATTTGAGGACTTGG - Intronic
1003864330 6:10349518-10349540 TGCAGTGGCAAAGGAGGAAGAGG - Intergenic
1004163220 6:13232884-13232906 TGTAGCAGAGCTGGAGGAATGGG - Intronic
1006820180 6:36887010-36887032 TGGAGTAGCTGTGGAGGAACAGG - Intronic
1008200893 6:48588676-48588698 TATAGTAGCAATGAAGGAGAAGG + Intergenic
1008240704 6:49107614-49107636 GGCACTAGCACTGGAGGAATAGG - Intergenic
1008460413 6:51763735-51763757 TGCAGGAGCAATGGAGAAGTGGG - Intronic
1008533223 6:52484164-52484186 TTTAGTATGAGTGGAGGAATTGG + Intronic
1010060282 6:71614845-71614867 TGGAGTAGAAATGGAGGATGGGG - Intergenic
1010502473 6:76617683-76617705 TGGAGTAGCCAAGGAAGAATGGG + Intergenic
1010734768 6:79431555-79431577 TGTATTATTAATGGAGGAATTGG + Intergenic
1010806777 6:80246492-80246514 TGTAGTAGCAATGGCAGGAAGGG - Intronic
1012589377 6:100961164-100961186 TGTTGTATCACTGGAGGGATTGG - Intergenic
1015586512 6:134782205-134782227 TGTGGCAGTGATGGAGGAATTGG - Intergenic
1015591465 6:134826757-134826779 TGTATAAGCAAAGCAGGAATAGG - Intergenic
1017326555 6:153147237-153147259 TGTAGTACCAATGTAGTATTGGG - Intergenic
1018723873 6:166595831-166595853 TGTATTACCAATAAAGGAATGGG + Intronic
1020446608 7:8275446-8275468 TGCAGTAGTAATGGTGGAAGTGG - Intergenic
1020521346 7:9191314-9191336 TTTAGTAATAATGGAAGAATGGG + Intergenic
1020817224 7:12920525-12920547 TGAAGGAGCAAGGGAGGCATGGG - Intergenic
1023499142 7:40829718-40829740 TGGAGTAGGAATGGAGGAAAGGG - Intronic
1031953812 7:127921713-127921735 TCTAAAAGGAATGGAGGAATTGG - Intronic
1033945426 7:146710556-146710578 TTAAGTAGCAATGAAGGGATAGG + Intronic
1034121629 7:148633227-148633249 TGCAGGAGCAATAGAGGAAAGGG - Intergenic
1036405645 8:8452784-8452806 TGCAGTAGCATTTGAGGAACTGG + Intergenic
1037648270 8:20813594-20813616 TGAAGGAGCAAGGAAGGAATCGG - Intergenic
1038261956 8:26003320-26003342 TCTAGTAGCAATGATGGAATAGG - Intronic
1041573504 8:59366019-59366041 TGTAGTTTCAATGGAGGAGGTGG - Intergenic
1042193106 8:66208197-66208219 TCTAGCAGCGATGGAGGTATAGG - Intergenic
1043169007 8:76940516-76940538 TATAGTAGAAATGTAGCAATGGG - Intergenic
1046712753 8:117530009-117530031 TGTATTACCAATGCAAGAATAGG - Intronic
1050501313 9:6300855-6300877 TGTAGAAGCTGTGGAGAAATAGG + Intergenic
1051969906 9:22876129-22876151 AGTGGTAGAAATTGAGGAATAGG - Intergenic
1056589608 9:87955592-87955614 GGGAGTAGAAAAGGAGGAATAGG - Intergenic
1058009314 9:99958892-99958914 AGTAGAAGCAATGGAGTCATGGG + Intronic
1203638626 Un_KI270750v1:137024-137046 AGCAGAAGCAATGGTGGAATAGG + Intergenic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1185608919 X:1382718-1382740 TCTAGTAGTGTTGGAGGAATGGG - Intergenic
1186069524 X:5803437-5803459 TGCATTAGCAATGGTAGAATTGG + Intergenic
1187429217 X:19206368-19206390 TGTAGTTGAAATGGAAGACTAGG - Intergenic
1187987061 X:24825441-24825463 TGTAGCAGGAATGAAAGAATAGG + Intronic
1189512561 X:41677681-41677703 TGTAGTAAAAATGGAGAAATGGG + Intronic
1190456033 X:50628551-50628573 AGTAGTAGCATTGGAGAAAGAGG - Intronic
1192274228 X:69613911-69613933 TGCAGTAGAAATGTTGGAATGGG - Intergenic
1192362381 X:70447891-70447913 TGTAGTAGCCATGCAAGAAGAGG - Intronic
1192845353 X:74901688-74901710 AGGAGTAACAATGGAGGAGTGGG - Intronic
1194574166 X:95591400-95591422 TGTAGTAAGTATGGAGGAAAGGG + Intergenic
1195345199 X:103943367-103943389 TGTAGAATGAATGGATGAATTGG + Intronic
1198606434 X:138343386-138343408 TGTTCTAGCAATTGATGAATGGG - Intergenic
1200830391 Y:7683232-7683254 TCTAGTTAGAATGGAGGAATAGG + Intergenic
1201675442 Y:16577525-16577547 TATAGTAACATTGGTGGAATTGG + Intergenic
1201684056 Y:16681825-16681847 TAAAGTAGCAAAGGAGGAAGAGG - Intergenic