ID: 911397904

View in Genome Browser
Species Human (GRCh38)
Location 1:97335190-97335212
Sequence CTGCAGCCATGGAAAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 497}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911397904_911397907 12 Left 911397904 1:97335190-97335212 CCCTCTTCTTTCCATGGCTGCAG 0: 1
1: 0
2: 1
3: 40
4: 497
Right 911397907 1:97335225-97335247 AACTAAGCTCATCAAATTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911397904 Original CRISPR CTGCAGCCATGGAAAGAAGA GGG (reversed) Intronic
900302798 1:1986396-1986418 GTGCAGCCATGGGGAGCAGAGGG - Intronic
900423121 1:2564298-2564320 CTGCAGCCATGCCATGAGGATGG + Intronic
900637877 1:3674729-3674751 CTCCAGCCACCGCAAGAAGAGGG - Intronic
900835177 1:4997768-4997790 TGGCAGCCATAGGAAGAAGAGGG - Intergenic
901298701 1:8182256-8182278 CCGCAGCCCTAGAAAGAGGAGGG - Intergenic
901572558 1:10173592-10173614 CTGCAGTGAGGGAAAGAAAAGGG + Intronic
901686706 1:10947396-10947418 CTGCTGCCATGGAACCCAGAGGG - Intronic
901737328 1:11320621-11320643 CTGCAGGCATGGGCAGAGGAGGG - Intergenic
902281136 1:15375336-15375358 CTTCAGCCATGGAACCAAGACGG - Intronic
902307023 1:15549161-15549183 CTGAAACCATGGAAACCAGATGG + Intronic
902646511 1:17803231-17803253 CTGCCGCCATGTGAAGAAGGAGG + Intronic
902908104 1:19574214-19574236 CTGCAGACAGGGAGAGATGAAGG - Intergenic
903193499 1:21669211-21669233 CTGCGGCCCTGGAAAGGGGAAGG - Intronic
903296463 1:22346384-22346406 CTGCTCCCATGGCAAGAATATGG - Intergenic
903570832 1:24303671-24303693 CTGCAGCCTGGGCAACAAGAGGG + Intergenic
903678656 1:25082744-25082766 CTGCAGGCATGGGAACAAGATGG - Intergenic
903933267 1:26876834-26876856 CTGCACCCATGGAGTGGAGATGG - Exonic
904232645 1:29089011-29089033 CTGGTGTCATGGGAAGAAGATGG + Intronic
904428793 1:30448567-30448589 CTGCTGGCATGGAAAGAACCAGG - Intergenic
905755768 1:40507978-40508000 ATACAGCCATGGAGAAAAGATGG - Intergenic
906467668 1:46097855-46097877 CTCCAGCCAGGGCAACAAGAGGG + Intronic
906543912 1:46608259-46608281 CTGAAGCCAGGAGAAGAAGAGGG - Exonic
906671327 1:47657108-47657130 CTGGAGCCATGGAAGTAAGGAGG + Intergenic
907046644 1:51303645-51303667 CTGCAGGCAGGGAAACAAGGTGG - Intronic
909095088 1:71276402-71276424 CTGCTGCCATGTGAAGAAGGAGG + Intergenic
909482888 1:76144265-76144287 CTGAGGCCAAGGAAAGAGGATGG + Intronic
910253240 1:85220251-85220273 CTGCAGCTATCCAAAGAAGTGGG - Intergenic
910711808 1:90189892-90189914 CTGCAGAGAGGGAAAGAGGAGGG - Intergenic
910802270 1:91158626-91158648 CCGCACCCATGCAAAGAGGAAGG - Intergenic
910881938 1:91929721-91929743 CTCCAGCCTGGGAAACAAGAGGG - Intergenic
911166268 1:94727255-94727277 CTGCAGCCCAGGAAACAAGCAGG - Intergenic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
912373601 1:109192588-109192610 CTGGAGACAAGGAAACAAGAGGG - Intronic
915236355 1:154485997-154486019 CTACAGCCCTGCAAAGAAGCTGG - Exonic
916930247 1:169570373-169570395 GTTCAGCAATGTAAAGAAGAAGG - Intronic
917392833 1:174557855-174557877 ATGCGGCCATGGAAAGCACATGG + Intronic
917737192 1:177932196-177932218 GTGAAGACGTGGAAAGAAGATGG + Intronic
918160999 1:181899548-181899570 TTGCAGCCATGACAAGAAAAAGG - Intergenic
918208978 1:182334114-182334136 CTGTAGTGATGGAAACAAGAAGG - Intergenic
918327572 1:183425069-183425091 CTCCAGCCATAGAAGGAATATGG - Intergenic
919224993 1:194686419-194686441 CTACAGCCTGGGCAAGAAGAGGG - Intergenic
919369730 1:196708322-196708344 AAGTAGCCATGGAAAGAAGCTGG - Intronic
919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG + Intergenic
919793282 1:201305972-201305994 CTGGGGCCATGGAAGGGAGATGG + Intronic
920219010 1:204382338-204382360 CTGCAGCTATTAACAGAAGAAGG - Intergenic
920845529 1:209590253-209590275 ATGCAGCCATGGAAGGAACATGG + Intronic
921684288 1:218072014-218072036 CTCCAGCCTGGGCAAGAAGAGGG + Intergenic
922430508 1:225547798-225547820 CTGTAGGCATGGGAAGATGAGGG - Intronic
922675935 1:227549843-227549865 CTGCATCCATGACAAGGAGATGG - Intergenic
922679886 1:227585159-227585181 CTGCATCCATGACAAGGAGATGG + Intronic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
923914653 1:238488402-238488424 TTGCAGCCATGAAACGTAGAAGG - Intergenic
923995785 1:239492686-239492708 CTGCAGACAGAGAAAAAAGACGG - Intronic
924946536 1:248850517-248850539 CTGGAGTCAGGGACAGAAGAGGG + Intronic
1063153099 10:3354680-3354702 CTGCCGCCATGTGAAGAAGGAGG + Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1065350608 10:24792553-24792575 CTGCTGCCATGTAAAGAAGGAGG - Intergenic
1067329504 10:45301764-45301786 CTGCAGCCAAGGGAAGCTGAGGG - Intergenic
1069102276 10:64336750-64336772 CTGCAGCCATCGCAACATGATGG - Intergenic
1069112519 10:64464765-64464787 CTCCAGCCATGGATAAAAGGGGG - Intergenic
1069888035 10:71636203-71636225 CTGGAGTCATGGAAAGCAGTTGG + Intronic
1070688208 10:78505389-78505411 CTGCAGCAATGGAAAGACAGGGG + Intergenic
1071388651 10:85147661-85147683 CTGCAGCCCTGCAGAAAAGAGGG - Intergenic
1071588250 10:86846334-86846356 CTCCAGCCTTGGGAAGAAGCTGG + Intronic
1071770613 10:88725769-88725791 CTGCAGATATACAAAGAAGAGGG - Intronic
1071788666 10:88931627-88931649 CTGCAGCCAAGTGAGGAAGATGG - Intronic
1072635441 10:97174624-97174646 CTCCAGCCAAGGAAACAAGATGG - Intronic
1073193798 10:101671612-101671634 CTGAAGCCATGACAGGAAGATGG + Intronic
1073730452 10:106281373-106281395 CTGTTGCCATGGAAGGAGGACGG + Intergenic
1073810824 10:107150811-107150833 CTGCTGCCATGTGAAGAAGGAGG + Intronic
1074364093 10:112844382-112844404 CTGAGGTCATGGAAAGGAGAAGG + Intergenic
1074536322 10:114330757-114330779 CTGCAGACATGGACAGATGTAGG - Intronic
1075361529 10:121840172-121840194 TTGCAGCCATGGACACAAAAGGG + Intronic
1075728962 10:124625081-124625103 CTGCAGCCTTTGAAAGAATCAGG - Intronic
1075743359 10:124709459-124709481 TGGCAGGCATGGAAAGGAGAAGG + Intronic
1075886902 10:125908026-125908048 CTCCAGCCTGGGAAACAAGAGGG - Intronic
1076476446 10:130756997-130757019 CTGCAGGAAAGGAAAGAGGAAGG + Intergenic
1076771509 10:132668363-132668385 ATGCTGCCATGGAAAAAATATGG + Intronic
1076912119 10:133395698-133395720 CTTCAGCCCTGGAAAACAGAAGG - Exonic
1077138859 11:1014723-1014745 CTGCAGCCAGGAAACGAAGCTGG - Intronic
1077316721 11:1922614-1922636 CTGGAGCCAGGGCAGGAAGAGGG + Intronic
1077706822 11:4494743-4494765 CTGCAGCCATGACAGGAATAAGG - Intergenic
1078930887 11:15911373-15911395 TTGGAGCCATGGAGGGAAGAAGG + Intergenic
1079154338 11:17930504-17930526 CTGCAGCCATGGGGAGAAGATGG + Intronic
1081067515 11:38564260-38564282 CTGCAGCCTGGGCAACAAGAAGG - Intergenic
1081087855 11:38823617-38823639 GAGCACCCATGGAAAGAAGCTGG + Intergenic
1081781449 11:45715947-45715969 CAGGAGGCGTGGAAAGAAGATGG + Intergenic
1082666031 11:55977203-55977225 CTTCAGCCTTGGCAACAAGAGGG + Intergenic
1082918512 11:58465967-58465989 CTACAGCCATGTAAGGAAGTTGG - Intergenic
1083057828 11:59839994-59840016 ATTCAGCCATGGAAAAAACAGGG + Intronic
1083429768 11:62608212-62608234 CTGCAGCCGGGGAATGAAGCTGG - Exonic
1083578391 11:63809213-63809235 CTGCAGCCTGGGCAACAAGAGGG - Intergenic
1083657587 11:64237049-64237071 CTCCAGCCTGGGCAAGAAGAGGG + Intronic
1084034419 11:66499952-66499974 CTGAAGCCATGGACAGTACAGGG - Intronic
1084164007 11:67366758-67366780 CTGGAGCCAGGGAAAGAAAAGGG - Intronic
1084276428 11:68053426-68053448 CTTCAGCCATGGGACCAAGAGGG + Exonic
1084955666 11:72690026-72690048 CTGCAGGCATGGAAAACACAAGG + Intronic
1085447622 11:76611095-76611117 CTCCGGCCATGGAGAGGAGAGGG + Intergenic
1086060557 11:82695721-82695743 CTGCAGGCAGTAAAAGAAGAGGG + Intergenic
1087015616 11:93551845-93551867 GTGCAGAGATGGAAAGAAAATGG + Intergenic
1087240960 11:95778660-95778682 CTGAAGCCATCTAATGAAGATGG - Intronic
1087823185 11:102734197-102734219 ATGCAGGCATGGAAATAAGTTGG - Intergenic
1089095463 11:115916570-115916592 CTGCAGTCATGAAGAGAGGAAGG + Intergenic
1089259810 11:117216469-117216491 CTCCAGCCTGGGCAAGAAGAGGG - Intronic
1089343814 11:117777640-117777662 CTGCAGCCAGGGTCAGAAGCAGG - Intronic
1092149053 12:6234508-6234530 CTACAGCCATAGAAATAGGAGGG + Intronic
1092216571 12:6688198-6688220 CAGGAGCCCTGGAAAGGAGAAGG - Exonic
1093718766 12:22413870-22413892 CTGCAGCCAGGGAGAGAGAAAGG + Intronic
1093896334 12:24578722-24578744 CTGCAGCCAGGAAAAGGAGTAGG + Intergenic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1095046618 12:37514483-37514505 CTGCAGCCTGGGCAACAAGATGG + Intergenic
1095613390 12:44159186-44159208 TTGCAGCCATGGGAAGTGGAAGG + Intronic
1096665320 12:53160409-53160431 CTGGCTCCAGGGAAAGAAGAGGG - Intronic
1096925933 12:55146563-55146585 CTGCAGCCTGGGCAACAAGAGGG - Intergenic
1097849637 12:64398976-64398998 CTTCAGCAATTGAAAGAAAAGGG + Intergenic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1099068113 12:78009417-78009439 CTGCAGCCTGGGTAACAAGAGGG + Intronic
1099276022 12:80577311-80577333 CTGCTGCCATGTGAAGAAGGAGG - Intronic
1100188998 12:92170625-92170647 CTGTAGCCATGGATGGAAGTGGG - Intergenic
1100542151 12:95567735-95567757 TTACAGCCATGGCAATAAGACGG + Intergenic
1101822844 12:108197238-108197260 CTGCTACCATGGAAGGAAGCAGG + Intronic
1102845044 12:116171574-116171596 CTGGAGCCATTGCAAGAGGAAGG - Intronic
1103088699 12:118081983-118082005 CTCCAGCCTGGGCAAGAAGAGGG + Intronic
1103352928 12:120298023-120298045 CTGCAGCCTTGAAAAAAAAAGGG + Intergenic
1105024176 12:132837768-132837790 CTGCAGCCGTGTAGAGAAGCCGG - Intronic
1105253764 13:18725725-18725747 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1105698415 13:22914518-22914540 CTTCAGCCATAGAAAGAAATGGG + Intergenic
1105850075 13:24326757-24326779 CTTCAGCCATAGAAAGAAATGGG + Intergenic
1106572047 13:30935475-30935497 CAGCAGCCAGAGAATGAAGAGGG + Intronic
1106684173 13:32040120-32040142 TGGCAGCCATGAAAAGAATAGGG + Intronic
1107979744 13:45723271-45723293 CTGATGCCTTGGAAAGAAAAGGG + Intergenic
1108944403 13:56003064-56003086 CTTCAGCCATGGCCAAAAGAGGG - Intergenic
1110002610 13:70224126-70224148 CTGCAGGCTTGAAAGGAAGATGG + Intergenic
1110041960 13:70773205-70773227 ATGCAGCCATAAAAAGAATAAGG + Intergenic
1110884831 13:80619624-80619646 CTGAGGCAATGGCAAGAAGAGGG - Intergenic
1112884899 13:104158359-104158381 CTGCTGCCATGTGAAGAAGAAGG - Intergenic
1112938254 13:104827580-104827602 CTGCATACATGGAAAGTACATGG - Intergenic
1113285925 13:108848976-108848998 CTGCAGCCAGGGAAAGGGAAAGG + Intronic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1116789281 14:49322518-49322540 CTTCAGCCATTGAAAGAATAAGG + Intergenic
1117538915 14:56727714-56727736 CTGCAGATATGGAAATAAGAAGG + Intronic
1117607977 14:57451276-57451298 CAGAAGCCATGAAAGGAAGAAGG - Intergenic
1117871842 14:60209361-60209383 CAGGAGCCATGTAGAGAAGATGG - Intergenic
1118106567 14:62666521-62666543 CTGCAGTCATAGAGAGCAGAAGG + Intergenic
1118151773 14:63197257-63197279 CAGTAGCCATGGACAGAAGTAGG - Intergenic
1118151976 14:63199520-63199542 CAGTAGCCATGGACAGAAGGTGG - Intergenic
1118160568 14:63285658-63285680 CTACAGTAATAGAAAGAAGAGGG - Intronic
1119660413 14:76447433-76447455 CTGAAGCCATGGATATGAGAAGG - Intronic
1119709258 14:76809505-76809527 CTGCAGCAGTGGCGAGAAGAAGG - Exonic
1120460294 14:84786662-84786684 CTGCTGACATGGAAGGTAGAAGG + Intergenic
1121615651 14:95311822-95311844 CTGTATCCCTGGAATGAAGAAGG - Intronic
1121709746 14:96028799-96028821 CTGCAGCTTGGGAAAGAAAAGGG - Intergenic
1122840022 14:104454731-104454753 CTTCAGCCATAGAAAGAAATGGG + Intergenic
1122849907 14:104522568-104522590 CTGCAGCCAGGGAGAGGATAAGG - Intronic
1202906242 14_GL000194v1_random:73767-73789 CTCCAGCCATGGAATTATGAGGG - Intergenic
1123699094 15:22901567-22901589 CTGCAGCTCTGGAAAGAAGCTGG - Intronic
1123820849 15:24029099-24029121 CTCCAGCCAGGGCAACAAGAGGG - Intergenic
1125393030 15:39215688-39215710 CTCCAGCCTGGGAAACAAGAGGG - Intergenic
1126155383 15:45560819-45560841 CTGCAGCCTGGGCAACAAGATGG + Intergenic
1126352533 15:47759429-47759451 CTGCTGACTTGGCAAGAAGATGG - Intronic
1127360634 15:58241988-58242010 CTGCTGACCTAGAAAGAAGAGGG + Intronic
1128165198 15:65458058-65458080 CTGCTACCATGTATAGAAGATGG + Intronic
1128386490 15:67152908-67152930 CTTCCCCCATGCAAAGAAGACGG - Intronic
1129633932 15:77294021-77294043 CTGCATTCATGGAAGGAAAAAGG + Intronic
1130071365 15:80649129-80649151 CTGGAGCGATGCAGAGAAGATGG + Intergenic
1130881420 15:88059131-88059153 CAGCAGCAATGGCAAGCAGAGGG + Intronic
1130886132 15:88094129-88094151 CTGCAGCCTTTGGAAGAAGTGGG + Intronic
1130926914 15:88392399-88392421 CTGCAACCTTGCAAAGGAGAGGG - Intergenic
1131080373 15:89529442-89529464 CTGCAGCCATGCTAGGTAGAAGG - Intergenic
1131132580 15:89909746-89909768 AAGCAGCCATGGAAAGAGGAAGG + Intronic
1131571607 15:93543046-93543068 CAGCAGCACTGGAAACAAGAGGG - Intergenic
1131646640 15:94352003-94352025 CTGCAGCCATGCCAAGGAAAAGG + Intronic
1131707817 15:95017495-95017517 CTGCATCCATGGATAGGAAAGGG + Intergenic
1133478929 16:6150687-6150709 TTCCAGCCGTGGAAAGAGGAAGG - Intronic
1133985367 16:10664264-10664286 CTGCAGGGAGGGAAGGAAGAGGG + Intronic
1134012928 16:10868651-10868673 CTGCAGCCAGGGAGAGAGGAAGG - Intergenic
1134225573 16:12387326-12387348 CTGCAGCCCTGGGAAGAATGGGG - Intronic
1134242078 16:12513516-12513538 CACCAGGCATGGACAGAAGAGGG - Intronic
1134855992 16:17519643-17519665 CTGCAAAAATGAAAAGAAGACGG + Intergenic
1136062819 16:27738261-27738283 CTGGAGCCAGGGAAGGAGGAAGG + Intronic
1136337441 16:29619446-29619468 CTCCAGCCTGGGAAACAAGAGGG - Intergenic
1137640266 16:50022906-50022928 ATCCAGCCATGCAAAGATGAGGG - Intergenic
1137937049 16:52644810-52644832 CTGCAGCCAGGGCATGAAGTAGG - Intergenic
1138318604 16:56091536-56091558 ATGCAGCCATGGAAACCACAAGG + Intergenic
1138951167 16:61915189-61915211 CTGTAGCCATGCAAACAGGAAGG - Intronic
1139024421 16:62796888-62796910 CTGCCTCCAAAGAAAGAAGAAGG + Intergenic
1139344762 16:66295862-66295884 CTGCAGCCTTGCAGAGAAGAGGG + Intergenic
1139732427 16:68958137-68958159 CTCCAGCCTGGGCAAGAAGAGGG + Intronic
1140082932 16:71767327-71767349 CTGCAGCCATGAAAATCAGTTGG + Intronic
1140383245 16:74510061-74510083 CTGCAGCCTGGGCAATAAGAGGG - Intronic
1140855145 16:78971516-78971538 CTACAGCCATGGAAAGAGAATGG + Intronic
1141034259 16:80614218-80614240 CAGCAGACCTGGGAAGAAGAGGG - Intronic
1141601501 16:85129314-85129336 CTCCAGCCTGGGCAAGAAGAGGG + Intergenic
1141753765 16:85977639-85977661 CTGCTGGCATGGAAATGAGAAGG - Intergenic
1142040376 16:87889737-87889759 CTCCAGCCCGGGCAAGAAGAGGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142506790 17:369441-369463 CTGAAGCCCTGGAAAGCAGGAGG - Intronic
1144607800 17:16683442-16683464 CTGCCGCCAGGGACAGAAGCCGG - Intergenic
1144732579 17:17537181-17537203 CTGCTGCCCTGGAAAGAAGGAGG + Intronic
1145031803 17:19510162-19510184 CTGCAGCCTGGGCAACAAGAGGG - Intronic
1146239342 17:31202436-31202458 CTGCAGGAATGGATAGAATATGG - Intronic
1147333696 17:39714303-39714325 CTGCAGCTATTGAAAGAACAAGG - Intronic
1147432631 17:40382587-40382609 CTCCAGCCTGGGAAACAAGAGGG - Intergenic
1147835286 17:43326141-43326163 CTGCAGCCATGACAGGAATAAGG - Intergenic
1148354820 17:46968806-46968828 CTGCAGTCATTGAATGCAGAAGG + Intronic
1148388287 17:47252481-47252503 CTGCAGCCAGGGGAGGTAGATGG + Intergenic
1149336843 17:55644224-55644246 CTGGAGCCCTGGTAAGGAGATGG + Intergenic
1150642659 17:66960125-66960147 CTGCAGCCCGGGCGAGAAGACGG - Intergenic
1150830741 17:68517475-68517497 CTGCTGCCATGTGAAGAGGATGG - Intronic
1152098431 17:78286686-78286708 CAGCAGCCCTGGAGAGAAGGAGG + Intergenic
1152463936 17:80455267-80455289 CTGCAGCAGGGGAAAGAAGGAGG + Intergenic
1153847464 18:9062901-9062923 CTTTAGCCAAAGAAAGAAGAAGG + Intergenic
1155493078 18:26418686-26418708 AAGCAGCCCTGGAAAGAAAAAGG - Intergenic
1155744460 18:29335392-29335414 ATTCAGCCATGAAAAGAATAAGG + Intergenic
1157131144 18:45008524-45008546 TTGCAGAGATGGAAAGAAAAAGG + Intronic
1157200105 18:45652788-45652810 GTGCTGCCTTGGAAAGCAGAAGG - Intronic
1157255423 18:46134384-46134406 CTCCAGCCTGGGAAACAAGAGGG + Intergenic
1157369951 18:47101724-47101746 CTGCGGCAATGGAAAGAGAAGGG - Exonic
1158197092 18:54900205-54900227 CTTCAGCCATGAAACTAAGATGG - Intergenic
1158666988 18:59441207-59441229 TTTCAGACATGGAAAGAAAAGGG + Intronic
1159507312 18:69354053-69354075 CTCCAGCCTGGGAAACAAGAGGG + Intergenic
1161191367 19:2958807-2958829 ATGGGGCCATGGGAAGAAGATGG - Intergenic
1161427170 19:4210066-4210088 GTCCAGCCATGGAAAGCAGGGGG + Exonic
1162345182 19:10114564-10114586 CTGCGGCCATGTAGAGTAGAGGG - Exonic
1162733876 19:12734900-12734922 CTCCAGCCTGGGAAACAAGAGGG - Intergenic
1165653863 19:37516164-37516186 CTCCAGCCTGGGCAAGAAGAGGG - Intronic
1165969152 19:39610928-39610950 ATGCAGCCATAAAAAGAACAAGG - Intergenic
1166273576 19:41734690-41734712 CACCAGCCATGGAAAGAGGCAGG - Intronic
1167078409 19:47263125-47263147 TTGCTACCATGGAAGGAAGAAGG + Intronic
1167240549 19:48340717-48340739 CTGCAACCATGGAGGGCAGAGGG - Intronic
1167315356 19:48759808-48759830 CTCCAGCCTTGGCAACAAGAGGG - Intergenic
1167919616 19:52772274-52772296 CTCCAGCCTGGGCAAGAAGAGGG + Intronic
927090147 2:19704492-19704514 TTTAGGCCATGGAAAGAAGAGGG - Intergenic
927472057 2:23384691-23384713 CTCCAGCCTTGGAAAGGAGCAGG - Intergenic
927643378 2:24859933-24859955 CTGCAGCCAGGGCACGTAGAGGG - Intronic
928228540 2:29476193-29476215 CTGCAGGCATGGGGAGGAGAGGG - Intronic
928573170 2:32628344-32628366 CGGCAGCAATGGAAACAGGAGGG + Exonic
928766343 2:34651012-34651034 ATGATGCAATGGAAAGAAGAGGG + Intergenic
930912936 2:56651888-56651910 CTCCAGCCATGGATACCAGAAGG - Intergenic
930967772 2:57352480-57352502 CGGCAGCTATGGAAATAATATGG - Intergenic
931098274 2:58967042-58967064 CTCCAGCCTGGGCAAGAAGAGGG - Intergenic
931459961 2:62441999-62442021 CAACAGGCATGGAAAGAACATGG - Intergenic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
931813620 2:65878841-65878863 CTTCAGGCCTGGAAAGAAGATGG + Intergenic
931883104 2:66587505-66587527 CTGGAGCTATGGAAGGAATAAGG + Intergenic
932499762 2:72173505-72173527 CTGGAGCTTTGGAAAGAGGAAGG + Intergenic
934488006 2:94735928-94735950 CTGAATCCATGGAGAGAAAAAGG - Intergenic
935461932 2:103347062-103347084 CTACAGCCATGGAAGGAAATGGG - Intergenic
936940734 2:117881900-117881922 CTGCTGCCAAGTGAAGAAGAAGG + Intergenic
937394082 2:121519385-121519407 CTGGAGGCAGGGACAGAAGAGGG + Intronic
938042248 2:128085251-128085273 GTTCAGCCATGAAAAGCAGAGGG - Intergenic
938341275 2:130538151-130538173 CTGCACTCATGGAAAGCACAAGG + Intergenic
938348556 2:130582558-130582580 CTGCACTCATGGAAAGCACAAGG - Intronic
939175686 2:138745109-138745131 CTGCAACCAAGAAAACAAGAAGG - Intronic
939209864 2:139160458-139160480 CAGCAGACATGGAAGGAACAGGG + Intergenic
939473767 2:142659125-142659147 ATGCAGCCATGGATATAAAAAGG - Intergenic
941508886 2:166381125-166381147 GAGCAGGCATGCAAAGAAGAAGG + Intergenic
941860814 2:170278151-170278173 CTGTAGCCTTGGAAACAATATGG + Intronic
941873832 2:170413315-170413337 CTACAGCACTGGAAAGGAGAAGG + Intronic
942077198 2:172366931-172366953 CTGCAGCTATGCCAGGAAGAGGG + Intergenic
942091621 2:172497181-172497203 ATTCAGCAATGGAAAGAAAAGGG - Intronic
943183481 2:184574996-184575018 CTGCTGCCTTGTGAAGAAGATGG - Intergenic
945070004 2:205980010-205980032 CATCATCCATGGAAACAAGAAGG + Intergenic
945506436 2:210647106-210647128 CTGCAGCCAAGGAGAGGGGAAGG + Intronic
947502651 2:230682790-230682812 CTACAGTCAAGGAAGGAAGAAGG + Intergenic
947662777 2:231882391-231882413 CTGGATCCATGGGAAGAAGTGGG - Intergenic
947766325 2:232640190-232640212 CTGCAGCCTTGGAACGTGGAAGG - Intronic
948170834 2:235900801-235900823 CAGCAGCCATGGCAGGAGGAAGG - Intronic
948442772 2:238006785-238006807 CTCCAGCCTGGGAAACAAGAAGG - Intronic
1168956474 20:1837818-1837840 CTGCAGCCACGAAGAGGAGAGGG - Intergenic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169372353 20:5037792-5037814 CTGCAGCCTGGGCAACAAGAGGG + Intergenic
1169372359 20:5037860-5037882 CTGCAGCCTGGGCAACAAGAGGG + Intergenic
1169474095 20:5915443-5915465 TTGCAACCATGTAAAGAACATGG - Intronic
1170099126 20:12679147-12679169 CTGCAACTATGGGTAGAAGAGGG - Intergenic
1170694365 20:18645303-18645325 CTGCAGAAATGGAAACAAGGAGG + Intronic
1171043429 20:21788320-21788342 CTGCAGCCATGGAGACCAGCAGG - Intergenic
1171541178 20:25958113-25958135 CTGCAGCCTGGGCAAAAAGACGG + Intergenic
1171799891 20:29602227-29602249 CTGCAGCCTGGGCAAAAAGACGG - Intergenic
1171844193 20:30254458-30254480 CTGCAGCCTGGGCAAAAAGACGG + Intergenic
1172849119 20:37947853-37947875 CTGCAGCCATGGGGCAAAGATGG - Intergenic
1173919461 20:46733012-46733034 GGGCAGCCATGGTGAGAAGATGG + Intronic
1173971443 20:47155656-47155678 CAGCAGCCCTGCAAAGGAGATGG + Intronic
1174503743 20:51003815-51003837 CTGCAGCCGTGAAAGGAAGCTGG - Exonic
1174608852 20:51782143-51782165 CTCCAGCCTAGGAAACAAGAGGG + Intergenic
1174952386 20:55056321-55056343 CTCCAGCCTGGGAAACAAGAGGG + Intergenic
1175060662 20:56239217-56239239 GTGCAGCCATTCACAGAAGAAGG + Intergenic
1176087241 20:63303760-63303782 CTGCACACCTGGAAAGAAAAGGG - Intronic
1176278577 20:64287684-64287706 CTCCAGCCTTGGACAAAAGAGGG - Intronic
1176625596 21:9088524-9088546 CTCCAGCCATGGAATTATGAGGG - Intergenic
1176839273 21:13825721-13825743 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1177221733 21:18202502-18202524 CTTCAGACATAGAAAGAAGGTGG + Intronic
1177403400 21:20635680-20635702 CTGGAGCCATTTAAAGAATATGG + Intergenic
1178529777 21:33366140-33366162 CTGCAGGCATTGAAGGAAGAGGG - Intergenic
1180523945 22:16236158-16236180 CAGCAGCAATGGAAAAAAGCTGG + Intergenic
1182171627 22:28235874-28235896 CTGAAACCATACAAAGAAGAGGG - Intronic
1183357569 22:37367803-37367825 CTGCGGTCAAGGAAAAAAGAAGG - Intergenic
1184056722 22:42056891-42056913 CAGAAACCATGGAAACAAGAAGG - Intronic
1184181759 22:42832951-42832973 CTACAGCCTGGGAAACAAGAGGG + Intronic
1184488541 22:44795962-44795984 CTGCAGACATGGAAAGGAGTAGG - Intronic
1185353371 22:50350260-50350282 CTCCAGCCAGGGCAACAAGAGGG - Intronic
949331701 3:2930742-2930764 CTGCATCCATGGAATGAAACTGG - Intronic
949695564 3:6690176-6690198 CTGAAATCATGGAGAGAAGAAGG + Intergenic
950954015 3:17031415-17031437 CTGCAGACATGAAAGGAGGAAGG - Intronic
954533201 3:51338493-51338515 CTGCAGCCATGTATTGTAGAAGG - Intronic
954842559 3:53524787-53524809 TTTCAGCCAAGGAAAGAAAATGG + Intronic
955329665 3:58036706-58036728 CTGCTCCCAAGGCAAGAAGAGGG + Intronic
955369743 3:58340691-58340713 CTCCAGCCTTGGTAACAAGAGGG + Intronic
955855800 3:63272104-63272126 CGACAGCAATGGAAAGGAGATGG - Intronic
955906472 3:63813106-63813128 TTGGAGCCATTAAAAGAAGAAGG - Intergenic
956495092 3:69816524-69816546 CTTCAGCCATGAAAAGCAGCTGG - Intronic
956694634 3:71907966-71907988 CAGCAGCCAGGGGATGAAGATGG + Intergenic
956797602 3:72730809-72730831 AAGCAGACATGGAAGGAAGAAGG - Intergenic
956798339 3:72735914-72735936 AAGCAGACATGGAAGGAAGAAGG - Intergenic
957860260 3:85939395-85939417 ATTCAGCCAAAGAAAGAAGAGGG - Intronic
958456328 3:94336315-94336337 CAGCAGCAATGGAAAGCAGCTGG + Intergenic
958733422 3:97982942-97982964 TAGCAGTCATGGAAAGAAGCAGG + Intergenic
958818214 3:98941696-98941718 GTCCAGCTAAGGAAAGAAGAGGG - Intergenic
960059685 3:113308263-113308285 CTTCATCTATGGAAAGAGGAGGG + Exonic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961431346 3:126886004-126886026 CTGCAGCCATGCTAGAAAGAAGG + Intronic
961545790 3:127632055-127632077 CTGGAGCCATGGAAATGACAGGG + Intronic
961669778 3:128520586-128520608 CTGCTACTAAGGAAAGAAGAAGG - Intergenic
962057853 3:131891752-131891774 ATGCAGCCATAAAAAGAATAAGG - Intronic
962602987 3:137009370-137009392 CTGGGGCCACTGAAAGAAGATGG + Intronic
964636242 3:158860625-158860647 CAGCAGCCAGGGAGGGAAGAGGG - Intergenic
964824038 3:160805947-160805969 TTCCAGCCATGGCAAGAATATGG - Intronic
965653526 3:170959390-170959412 CACCAGCCATGGAAAGGAGAAGG - Intergenic
965961983 3:174440253-174440275 CTGAAGCGAGGGAAGGAAGAAGG - Intronic
967185649 3:186942288-186942310 CTGAAGCCAAGGACAGAACAGGG - Intronic
969034797 4:4244581-4244603 ATGCAGCCGTGGGAAGAATATGG + Intronic
969414964 4:7052158-7052180 CCGCAGCCTTGGACAGAAGCTGG + Intronic
969425064 4:7119449-7119471 CTGCAGCCCTGGGAGGAAGAGGG - Intergenic
969941221 4:10733696-10733718 CTACAGCCAGCAAAAGAAGATGG - Intergenic
971318882 4:25589274-25589296 CACCAGCCATGGAAGGAAGATGG + Intergenic
971632845 4:29016904-29016926 CTGCAACCATATAGAGAAGAGGG - Intergenic
972598959 4:40554965-40554987 CTGCAGCCTGGGCAACAAGAGGG - Intronic
972946490 4:44263106-44263128 CTGCAGCAACGGAAAGCATATGG + Intronic
972972479 4:44594185-44594207 CTCCAGCAATGGAAAAAAGCTGG + Intergenic
973535766 4:51880505-51880527 CAGGAGCCACGGAAAGCAGAGGG - Intronic
974078739 4:57191780-57191802 CTGCTGCTATGGATAGAAGTAGG - Intergenic
975757771 4:77587977-77587999 CTGCATCCCTTGAAAGAAGCAGG - Intronic
975884114 4:78943887-78943909 CTGAAGCCATGGAAATATAAAGG - Intergenic
976370073 4:84277761-84277783 GTGAAGTCATGGAAAGAGGATGG - Intergenic
978634792 4:110791478-110791500 GTGCAGCCATGAAAAGAACCTGG - Intergenic
979402547 4:120266163-120266185 CTGGAGCAAGGGAAACAAGAGGG - Intergenic
980028442 4:127795060-127795082 CTGCAGCAATGGAAGCAACATGG + Intronic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
981824376 4:148923318-148923340 TGGTAGCCATGGAAAGAATAAGG - Intergenic
982182181 4:152758948-152758970 CTCCAGGCATGGAAAGAAAGTGG - Intronic
982714515 4:158792800-158792822 CTGCAGCCTTAGAATGGAGAAGG + Intronic
982969110 4:161958360-161958382 CAGCAGACATGGAAAGAATCAGG - Intronic
983213440 4:164980582-164980604 CTGCAGCCATAAAAAAATGAGGG + Intergenic
983269542 4:165545167-165545189 CTGCAGCAATTCAAAGAAGGGGG + Intergenic
983443855 4:167823918-167823940 TTGCAGCAGTGGAAACAAGATGG - Intergenic
984315323 4:178122292-178122314 CTGCAGCCAGGGAACGAATTTGG + Intergenic
984317001 4:178141055-178141077 CTCCAGCCCTGTAAAGAAGGGGG - Intergenic
984987642 4:185346914-185346936 CTGCAGCGATGGGAGGAAGCTGG - Intronic
985362975 4:189194871-189194893 CTGCCACCATGTGAAGAAGAAGG + Intergenic
985679498 5:1248585-1248607 ATGCAGCCATGGATAAAAGTGGG + Intergenic
985838411 5:2287972-2287994 CTGCTGTCCTGCAAAGAAGACGG + Intergenic
986025155 5:3843768-3843790 CGCCAGCCATGGAAAGGGGATGG - Intergenic
986585240 5:9309559-9309581 CTGGAGGCATGGATTGAAGACGG + Intronic
987098408 5:14570547-14570569 TTGAAGCCAGGGAAGGAAGAAGG - Intergenic
988853503 5:35202532-35202554 ATGCAGCCATGGCCAGAAGGGGG - Intronic
991019391 5:61964199-61964221 CTGCAGCCCTTTAAGGAAGATGG - Intergenic
991432925 5:66567222-66567244 CTGAAGCCAATGGAAGAAGAGGG + Intergenic
991622336 5:68557949-68557971 CTGGAGCCTTGGAAGGGAGAGGG - Intergenic
992035267 5:72767740-72767762 CTGCAGCCAAGGGAGAAAGAAGG + Intergenic
992159156 5:73983804-73983826 ATCCAGCCATGGAAAGAGGGAGG + Intergenic
992472982 5:77076610-77076632 CAGCAGTCATGGAAACTAGAGGG + Exonic
992774425 5:80077175-80077197 CTGCAGCTATGCAGAGAAGCTGG - Intronic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
995808367 5:116079245-116079267 CTGAAGCCTTGGAAACAAGTGGG - Intergenic
997781496 5:136663784-136663806 GATGAGCCATGGAAAGAAGATGG + Intergenic
998160213 5:139808954-139808976 CTGGAGCCAGGGTAAGAACACGG + Intronic
998919212 5:147049332-147049354 CTCCAGCCTAGGAAATAAGAGGG - Intronic
999316661 5:150588514-150588536 CAGCAGCCATGGAAGAAAGTAGG + Intergenic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
1001190600 5:169627262-169627284 CAGCATCCAGGGAAAGATGATGG - Intergenic
1001453536 5:171844136-171844158 CTGGATTCATGGAAAGATGAAGG + Intergenic
1001700615 5:173704118-173704140 CTGCAGCCATGGCCAGATGAAGG + Intergenic
1001762820 5:174222105-174222127 ATGCTGCCATGGGAAGAACAGGG + Intronic
1001941867 5:175746058-175746080 CTGCAGCCATAAAAGGGAGAGGG - Intergenic
1001971139 5:175955989-175956011 CTGTAGCCTTGAAAAGAGGATGG - Intronic
1002246303 5:177887788-177887810 CTGTAGCCTTGAAAAGAGGATGG + Intergenic
1002452501 5:179326849-179326871 CTGAAGTCATGGGAAGGAGAGGG + Intronic
1002754548 6:147563-147585 CTCCAGCCTTGGACAAAAGAGGG + Intergenic
1002796533 6:475386-475408 ATGCTGCCATGGAAAGAACGGGG + Intergenic
1003330562 6:5125113-5125135 CTGCAGCCACGGTAAGGAGAAGG + Intronic
1003764986 6:9225678-9225700 CTGCATTCATGGAAAGAATAGGG - Intergenic
1004467121 6:15896277-15896299 AAGCAGCCATGGAAGGGAGACGG - Intergenic
1005810525 6:29511963-29511985 CTGACACCATGTAAAGAAGAAGG - Intergenic
1005825565 6:29629741-29629763 CTGCATCCCAGGAGAGAAGATGG + Intronic
1005994453 6:30922875-30922897 CTGCAACCAGAGGAAGAAGAAGG - Intronic
1006200666 6:32287064-32287086 CTGCATCAATGGAAGGGAGATGG + Intergenic
1007298801 6:40850100-40850122 CTGCAGCCACCCAAAGAAGGAGG + Intergenic
1007496734 6:42265098-42265120 CTGAAGCCTTGGTATGAAGAAGG - Intronic
1007568391 6:42871103-42871125 CTGCAGCCTGGGCAACAAGAGGG - Intergenic
1007631040 6:43273886-43273908 CTGCAGCCCTGGACAGAGGGTGG - Intronic
1007833688 6:44657827-44657849 CTGCAGCCATGGCAAGAGTGAGG + Intergenic
1007974302 6:46085293-46085315 CAGCAGCAATGGAAAAAAGCTGG - Intergenic
1011571761 6:88745687-88745709 TTCCAGCCATGTAATGAAGAAGG - Intronic
1011644744 6:89446900-89446922 CTGCTGCCATGTGAAGAAGGAGG + Intronic
1011649703 6:89494440-89494462 CTGAAGCCAAGTCAAGAAGAGGG + Intronic
1012027438 6:94014752-94014774 CGGTAGCAAAGGAAAGAAGAAGG - Intergenic
1012372384 6:98523399-98523421 CTGCAGGCATGGAAGTAAAATGG + Intergenic
1013092428 6:106912357-106912379 CTCCAGCCAAAGAAAGCAGATGG - Intergenic
1013237075 6:108206713-108206735 CTGCAGCCAGGGAAGGGAGTAGG - Intergenic
1013610360 6:111788917-111788939 CTGCAGGCAGGGGAAGCAGATGG - Intronic
1013662584 6:112313143-112313165 CTGATGCCAGGAAAAGAAGATGG - Intergenic
1014234110 6:118936092-118936114 CTGCAGCCCTGTGAAGAAGGAGG - Intergenic
1014418438 6:121212484-121212506 CTCCAGCCTGGGAAACAAGAGGG - Intronic
1014828465 6:126073900-126073922 CTGCTGCCATGTGAAGAAGGAGG - Intergenic
1015379588 6:132551397-132551419 CTGCAGGGATGAAAAGAGGATGG - Intergenic
1015765365 6:136710640-136710662 CTGCAGCCAGCGAAAGAAGTGGG + Intronic
1016888309 6:148980318-148980340 CAGCAGCCGTGGAGAGAAGATGG - Intronic
1017764282 6:157593847-157593869 CTCCAGCCACAGAGAGAAGAGGG - Intronic
1017986189 6:159445091-159445113 CTATAGCCATAGAAAGCAGATGG - Intergenic
1018070117 6:160157291-160157313 CTCCAGCCAGGGCAACAAGAGGG - Intronic
1018645489 6:165944084-165944106 CTGCTGCCATGTGAAGAAGGAGG - Intronic
1018827030 6:167415941-167415963 CTGGACCCCTGGAAGGAAGAGGG - Intergenic
1018927277 6:168215127-168215149 CTGGAGCCATGGAAATGAGAGGG - Intergenic
1019693260 7:2429679-2429701 CTGCAGCCATTGAAAGGATAAGG - Intronic
1022181045 7:27920634-27920656 CTGCTGGCCAGGAAAGAAGAGGG - Intronic
1022529530 7:31058181-31058203 CTTCAGCCAGGGGAAGCAGAAGG + Intronic
1022683899 7:32576752-32576774 CTGCAGCCTGGGTAACAAGAGGG + Intronic
1022716433 7:32902950-32902972 CTGCAGCCATTGGAAGATCATGG + Intergenic
1023943732 7:44786937-44786959 CTCCAGCCTTGGCAACAAGAGGG + Intergenic
1024047986 7:45598010-45598032 CTGCAGGCAAGGACAGATGAAGG - Intronic
1024344852 7:48302674-48302696 ATGCAGCCATAAAAAGAACAAGG - Intronic
1024883662 7:54117065-54117087 CTGCAGCCAAGGAAGGGAGGAGG + Intergenic
1025132181 7:56380903-56380925 CTCCAGCCTTGGAAAAGAGAGGG + Intergenic
1025939595 7:66065428-66065450 CTACAGCCTTTGAAAGAGGATGG + Intergenic
1026712032 7:72750392-72750414 CTGAAACCATGGAAGCAAGAAGG - Intronic
1027123856 7:75541981-75542003 CTGCAAGGATGGAAACAAGAAGG + Intronic
1027243297 7:76347552-76347574 CTCCAGCCTGGGAAATAAGAGGG + Intronic
1027987260 7:85309118-85309140 CTGCAGCCATTGCAAACAGAGGG - Intergenic
1028473708 7:91231659-91231681 CTGCAACAAAGGAAAAAAGAGGG + Intergenic
1029275457 7:99401358-99401380 CTCCAGCCTGGGCAAGAAGAGGG - Intronic
1029356885 7:100058575-100058597 CTGAAGCTATGGAAAGAGGTGGG + Intronic
1030301840 7:107982087-107982109 CTGCAGACCTAGGAAGAAGAGGG - Intronic
1030920543 7:115379747-115379769 ATGCAGCCATAGAAAGAATAAGG + Intergenic
1031217793 7:118919888-118919910 CTGCAGCCACTGAAAGGAGTAGG + Intergenic
1031248596 7:119350498-119350520 CTGCTGCCATGAAAAGCAGCAGG + Intergenic
1032164234 7:129533147-129533169 CTGCCACCATGTACAGAAGATGG + Intergenic
1032500123 7:132393832-132393854 CTGCTGCCATGGTCTGAAGATGG - Intronic
1033346264 7:140527496-140527518 CTGCAGCCGGGGAGAGAACAGGG + Intronic
1036729355 8:11248707-11248729 CTGCAACAATGCAAAGGAGAAGG - Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1037832066 8:22195613-22195635 CTGGTGCCAGGGAAAGAACAGGG - Intronic
1037953192 8:23032347-23032369 CATCAGCCATGGGAAGAAAACGG + Intronic
1038169579 8:25116924-25116946 CCTCTTCCATGGAAAGAAGAAGG + Intergenic
1038284124 8:26191669-26191691 ATGCAGCCTTGGAAAAAAGATGG - Intergenic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1038546871 8:28432540-28432562 CTACAGCCATTGAAAGACTAGGG - Intronic
1038880265 8:31603739-31603761 CTGCAGCAATTAAAAGAAAAAGG - Intergenic
1041470670 8:58205136-58205158 CTCCAGCCTGGGCAAGAAGAGGG - Intergenic
1041600965 8:59716931-59716953 CTGAAGGCCTGGGAAGAAGAAGG - Intergenic
1042068836 8:64908054-64908076 ATGCAGCCATAAAAAGAAGGAGG + Intergenic
1042694559 8:71542392-71542414 ATGCAGCCAAGAAAAGAATAAGG - Intronic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1043389636 8:79779855-79779877 CTTCAGGAATGGAAAGAATAAGG + Intergenic
1043537956 8:81226749-81226771 CTCCAGGCAAGGAAGGAAGATGG - Intergenic
1043548789 8:81344998-81345020 CTGCAGCCTGAGAAAGAACAGGG + Intergenic
1043847521 8:85178836-85178858 CTACATCCAGGGAAAGGAGAGGG - Intronic
1044384056 8:91566666-91566688 CTGCAGGCATGGTAAAATGAAGG - Intergenic
1044413271 8:91908804-91908826 CTGTAGCAGTGGAAATAAGAGGG - Intergenic
1046479023 8:114789818-114789840 CTGCAGCCATGTTAAAAAGAAGG + Intergenic
1047576575 8:126162237-126162259 CTGAAGTCAGTGAAAGAAGATGG + Intergenic
1047755448 8:127914847-127914869 CTCCAGCCTGGGAAACAAGAGGG - Intergenic
1049002995 8:139837952-139837974 CTGCAGCCTGGGCCAGAAGAGGG - Intronic
1049616903 8:143579510-143579532 CTTTTGCAATGGAAAGAAGAGGG + Intergenic
1049619061 8:143589619-143589641 CTGCACCCATGGAAACCAGGTGG - Exonic
1050857381 9:10377083-10377105 TTACAGCCATGGATAGTAGAAGG - Intronic
1051251678 9:15165649-15165671 CTGCCGCCCTGTGAAGAAGAAGG - Exonic
1052235248 9:26205378-26205400 CTGCAGCCAGGGAAAGAGAAAGG + Intergenic
1053020605 9:34691430-34691452 CAGGAGCCAAGGAAAGCAGAAGG - Intergenic
1053669791 9:40348491-40348513 CTGAATCCATGGAGAGAAAAAGG + Intergenic
1053919588 9:42974746-42974768 CTGAATCCATGGAGAGAAAAAGG + Intergenic
1054514821 9:66027805-66027827 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1054878447 9:70120913-70120935 CTGCTGCCATGGTGAGCAGACGG - Intronic
1055782079 9:79830950-79830972 CTACAGCCCTAGAAAGAATAAGG - Intergenic
1056666383 9:88584025-88584047 GTGCAGGCATGGAGAGAAGGTGG - Intronic
1057405789 9:94769684-94769706 ACCCAGCCATGGAAAGAGGAGGG + Intronic
1057555618 9:96085465-96085487 CGGCAGCCATGGAAAGAGGTGGG - Intergenic
1058017393 9:100050118-100050140 CTCCAGTGATGGAAAGTAGATGG + Intronic
1058524272 9:105841161-105841183 TTGCAGCCTTGTACAGAAGATGG - Intergenic
1058584032 9:106487571-106487593 CTGCAGCAAAGGAACAAAGAGGG - Intergenic
1058712982 9:107697257-107697279 CTGCAGCAATGAGGAGAAGATGG + Intergenic
1058936225 9:109772005-109772027 CTGTCCCCACGGAAAGAAGAAGG - Intronic
1059466189 9:114470282-114470304 AGGCAGCCAGGGACAGAAGAGGG + Intronic
1059466661 9:114473055-114473077 CAGCAGCCACAGAAACAAGATGG - Intronic
1060240571 9:121898943-121898965 CAGGAGCCAGGCAAAGAAGAAGG - Intronic
1060251634 9:121990942-121990964 CTGCAGCTATGGAGAGCGGATGG + Intronic
1060555894 9:124507061-124507083 CGGCAGCCCAGGGAAGAAGAGGG + Intronic
1060797188 9:126520673-126520695 CAGCTGGCATGGAAAGGAGATGG + Intergenic
1060826315 9:126690110-126690132 CTGCAGCCTGGGGAAGCAGAGGG + Intronic
1061952098 9:133942388-133942410 CTGCAGCCCTGGGAACAATAAGG + Intronic
1062229239 9:135472279-135472301 CTGCTGCCACGGAAACAAGAAGG + Intergenic
1203748765 Un_GL000218v1:58985-59007 CTCCAGCCATGGAATTATGAGGG - Intergenic
1186057760 X:5668131-5668153 CTGCAACCCTGGCAAGAAAATGG - Intergenic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1187235929 X:17467075-17467097 CCTCAGACATGGTAAGAAGAAGG + Intronic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1187565330 X:20443957-20443979 CTGTAACCATGGCAAGGAGAGGG + Intergenic
1187751583 X:22471589-22471611 CTACTGCCCTGAAAAGAAGATGG + Intergenic
1187973724 X:24684078-24684100 CTGCAGTCAGGGAAAGGAGCAGG + Intergenic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1188548320 X:31334826-31334848 CTGAAGCCAAGGAAGAAAGATGG - Intronic
1188596368 X:31906178-31906200 CTGCTGCCATGTGAAGAAGAAGG + Intronic
1188889005 X:35586597-35586619 CTGCTGCCATGTGAAGAAGGAGG - Intergenic
1190603678 X:52118622-52118644 CTGCAGACAGGGTAAGAAAATGG + Intergenic
1192451557 X:71248150-71248172 CTGCAGCGAAGGTAAGGAGATGG - Exonic
1192961478 X:76135926-76135948 CTGCAGCCTGGGCAACAAGAGGG - Intergenic
1193102660 X:77633314-77633336 CTGCAGAGGTGGCAAGAAGATGG - Exonic
1194549577 X:95279863-95279885 TTGCAGCCATAAAAAGAATAAGG + Intergenic
1194786099 X:98086130-98086152 CTGCTGCCATGTGTAGAAGAAGG - Intergenic
1194978256 X:100414218-100414240 CTGCAGCCAGGGCAAAGAGAAGG - Intergenic
1195572557 X:106412816-106412838 ATGCAGCCATGAAAAAAGGATGG + Intergenic
1197095706 X:122592096-122592118 TTGTAGCCAGGGAGAGAAGAAGG + Intergenic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1197216913 X:123875052-123875074 CTCCAGCCTGGGAAACAAGAGGG - Intronic
1197334684 X:125198748-125198770 CTACTGCCATGGAAACTAGATGG - Intergenic
1197562257 X:128037863-128037885 CTCCAGCCTGGGCAAGAAGAGGG - Intergenic
1197702603 X:129610484-129610506 CTTCAGCCTTGGAGACAAGATGG + Intergenic
1198578580 X:138037447-138037469 CTTCATCTGTGGAAAGAAGAGGG + Intergenic
1199050455 X:143231344-143231366 CTGCAGCCAGAGTAAGATGATGG + Intergenic
1199200244 X:145078844-145078866 CTGGACCCAGGGAAACAAGATGG + Intergenic
1201162121 Y:11173954-11173976 CTCCAGCCATGGAATTATGAGGG - Intergenic
1201624572 Y:16000439-16000461 ATGCAGCCTTGGAAAAGAGATGG + Intergenic