ID: 911404206

View in Genome Browser
Species Human (GRCh38)
Location 1:97415802-97415824
Sequence TAGCATGTGCAGCTTGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911404201_911404206 28 Left 911404201 1:97415751-97415773 CCATTCTCTGTGATAAAGATTGT No data
Right 911404206 1:97415802-97415824 TAGCATGTGCAGCTTGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911404206 Original CRISPR TAGCATGTGCAGCTTGTACA GGG Intronic
No off target data available for this crispr