ID: 911404545

View in Genome Browser
Species Human (GRCh38)
Location 1:97420257-97420279
Sequence CAGTATCTGCATCTGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911404545_911404550 -3 Left 911404545 1:97420257-97420279 CCGTCTTCCAGATGCAGATACTG No data
Right 911404550 1:97420277-97420299 CTGCGTCGAAGGGAGGCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 83
911404545_911404551 23 Left 911404545 1:97420257-97420279 CCGTCTTCCAGATGCAGATACTG No data
Right 911404551 1:97420303-97420325 TGAGCAGCAAATTGAAGACATGG No data
911404545_911404549 -10 Left 911404545 1:97420257-97420279 CCGTCTTCCAGATGCAGATACTG No data
Right 911404549 1:97420270-97420292 GCAGATACTGCGTCGAAGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911404545 Original CRISPR CAGTATCTGCATCTGGAAGA CGG (reversed) Intronic
No off target data available for this crispr