ID: 911407731

View in Genome Browser
Species Human (GRCh38)
Location 1:97463659-97463681
Sequence AAAAATGCTGATAATGATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1118
Summary {0: 1, 1: 4, 2: 36, 3: 143, 4: 934}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911407729_911407731 4 Left 911407729 1:97463632-97463654 CCTAGTGACTTGTTGAATAGCTT No data
Right 911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG 0: 1
1: 4
2: 36
3: 143
4: 934
911407728_911407731 5 Left 911407728 1:97463631-97463653 CCCTAGTGACTTGTTGAATAGCT 0: 1
1: 11
2: 267
3: 270
4: 262
Right 911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG 0: 1
1: 4
2: 36
3: 143
4: 934

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911407731 Original CRISPR AAAAATGCTGATAATGATAA GGG Intronic
900716010 1:4144481-4144503 AAGAATGGTGGTGATGATAATGG - Intergenic
900716053 1:4144816-4144838 AACGATGGTGATGATGATAATGG - Intergenic
900805800 1:4767530-4767552 AAAGATGGTGATGATGATAATGG - Intronic
900805807 1:4767596-4767618 AAAGATGGTGATGATGATAATGG - Intronic
900894316 1:5472808-5472830 TAAAATGGGGATAATGACAAAGG - Intergenic
900941703 1:5802871-5802893 GATGATGCTGATGATGATAATGG - Intergenic
901367707 1:8767628-8767650 AAAAATGCTGCTTATCAAAAAGG + Intronic
901760850 1:11470311-11470333 AATAATAATAATAATGATAACGG + Intergenic
901870667 1:12137312-12137334 AAAAATAATAATAATAATAATGG + Intronic
902548106 1:17202951-17202973 AAAGATGATGATGATGATGATGG - Intergenic
902555362 1:17243526-17243548 ATAAATGCTAACAATGATCAGGG + Intronic
902556819 1:17251780-17251802 TAAACTGATGATGATGATAATGG - Intronic
902658158 1:17883672-17883694 TACAATGGGGATAATGATAAAGG + Intergenic
903048433 1:20582721-20582743 AAAAAGTTGGATAATGATAAGGG - Intergenic
903083966 1:20838334-20838356 GAAAATTCTGGAAATGATAATGG - Intronic
903177841 1:21591165-21591187 AATAATAATGATGATGATAATGG + Intergenic
903421830 1:23223342-23223364 TAAAATAATGATAATAATAATGG - Intergenic
903434561 1:23336900-23336922 TAAAATGGTAATAATAATAATGG + Intronic
903748861 1:25606653-25606675 GAAAATGAGGATAATGATACTGG - Intergenic
903801184 1:25969566-25969588 TAAAATGCAGTTAATAATAAAGG + Intronic
904413329 1:30338661-30338683 AATGATGGTGACAATGATAATGG + Intergenic
904413336 1:30338748-30338770 AATGATGGTGACAATGATAATGG + Intergenic
904434946 1:30488627-30488649 AATAATGGTGATGATGATAGTGG + Intergenic
905379538 1:37551359-37551381 TGAAATGCTGATAAAGATACAGG + Intronic
906326688 1:44850548-44850570 AGAAAGGCTGATTAGGATAAGGG + Intronic
906386908 1:45377725-45377747 AAGGATTCTAATAATGATAAGGG + Intronic
906439382 1:45827642-45827664 AAAAATAATGATGATGATGATGG - Intronic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
907167535 1:52427772-52427794 AAAAATGATGAATTTGATAATGG + Intronic
907350156 1:53822787-53822809 AATAATGATGATAATGATAATGG + Intronic
907724714 1:57008421-57008443 AATGATGATGATAATGATGATGG + Intronic
908285391 1:62592747-62592769 ACAAATGCTTTTAATGAAAAAGG - Intronic
908371561 1:63485123-63485145 AATAATGCTATTAATGAAAATGG + Intronic
908431719 1:64064992-64065014 AAAAGTGCTTGTTATGATAAAGG - Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
908941435 1:69439287-69439309 AAAAATGCAGAAAATTATAGAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909132978 1:71763011-71763033 AAAAATGCTAAAAATAAAAAGGG + Intronic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909324550 1:74333661-74333683 AAATATGCTGACAAGGAGAATGG + Intronic
909371364 1:74886372-74886394 AAAAATCCTAAAAATCATAAGGG + Intergenic
909709227 1:78625527-78625549 AACACTGCTGACACTGATAAAGG - Intronic
909954240 1:81758087-81758109 AAGAATGCTGAATAAGATAAAGG - Intronic
910003873 1:82370864-82370886 AAAAATGCCTATAATTATGAAGG + Intergenic
910478953 1:87637778-87637800 ATAATTGCTGATAATAATCATGG - Intergenic
910553683 1:88505617-88505639 AAAAAAATTGATATTGATAAAGG + Intergenic
910568450 1:88673284-88673306 AAAAATGATGTTAATAATATAGG + Intergenic
910888246 1:91989357-91989379 AAAAATAATCATAATCATAAAGG - Intronic
911063277 1:93765601-93765623 AATAATGATAATAATAATAAAGG - Intronic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911431418 1:97792636-97792658 TAAAGTGGAGATAATGATAATGG - Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912158830 1:106955775-106955797 AACAATGCTGATAATGCAAGTGG - Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912533876 1:110348462-110348484 ATAAATACTGAAAATGTTAAGGG - Intergenic
913391363 1:118316547-118316569 AGAAATGCACCTAATGATAATGG - Intergenic
913680087 1:121181634-121181656 AATAATGCTGTTAATGAACATGG + Intronic
914031921 1:143969287-143969309 AATAATGCTGTTAATGAACATGG + Intronic
914157523 1:145098680-145098702 AATAATGCTGTTAATGAACATGG - Intronic
914404727 1:147359016-147359038 AAAAATGCTGAAAATTCAAAAGG + Intergenic
914724136 1:150313189-150313211 AATAATAATAATAATGATAATGG + Intergenic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
915383590 1:155468214-155468236 AAAAATAATAATAATAATAAAGG - Intronic
915866651 1:159507252-159507274 AATGAAGCTGATAAAGATAATGG - Intergenic
916236084 1:162590372-162590394 AAGAATGCTGATAGTCAGAATGG + Exonic
916376659 1:164162021-164162043 AAAAATGTTAACAAGGATAAGGG + Intergenic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917687045 1:177427229-177427251 AAACATCCTGAAAATGAAAATGG + Intergenic
917739841 1:177951797-177951819 AAAAGTGATGATAATATTAATGG - Intronic
917745251 1:178000519-178000541 TAAAATGATGATAATAGTAATGG - Intergenic
917771536 1:178285009-178285031 AAAAATGCTGAGAAAGAGAAGGG - Intronic
917846203 1:179022616-179022638 GAAAATGCTTACAATGATGAAGG + Intergenic
917864859 1:179184636-179184658 GAAGATGATGATGATGATAAAGG + Intronic
918553413 1:185770690-185770712 ATAAATGCTGAAAAAGATTAAGG - Intronic
918568562 1:185959658-185959680 GATAATGGTGATAATGATGATGG + Intronic
918646588 1:186913011-186913033 ATAAATCTTGTTAATGATAATGG + Intronic
918942607 1:191020696-191020718 AAACATGATGATCATGATGACGG + Intergenic
919259443 1:195172889-195172911 AAAGATGATGATGATGATGACGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920074824 1:203328312-203328334 AAAAATACTAATGATAATAATGG + Intergenic
920222572 1:204414735-204414757 AAAAAAGCTGAGAATTATTATGG - Intergenic
920467397 1:206200170-206200192 AATAATGCTGTTAATGAACATGG + Intronic
920605537 1:207380431-207380453 AAAAATACTGAAAAAGAAAATGG - Intergenic
920720677 1:208383960-208383982 ACAGAAGCTGATAATGAAAAGGG - Intergenic
920723570 1:208412741-208412763 AAAAATGATGATGATGATAGTGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921633016 1:217456993-217457015 AAAAATATTAATAATGAGAAGGG - Intronic
921660878 1:217800999-217801021 AATGATGATGGTAATGATAATGG + Intronic
921663164 1:217832437-217832459 ATAAATGCTGACAATAAAAATGG + Intronic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922254673 1:223883369-223883391 AAAAATAGTAATAATAATAATGG + Intergenic
922403149 1:225282117-225282139 AAAAATGCTAAAAATGCTCAAGG + Intronic
922577154 1:226669043-226669065 AATAATAATGATGATGATAATGG - Intronic
922782136 1:228261163-228261185 CAAAATAATGATAATAATAATGG - Intronic
923073201 1:230584629-230584651 AAAAATGATGATAAAGAGAATGG + Intergenic
923199958 1:231702003-231702025 GAGAATGATGATTATGATAAAGG + Exonic
923569318 1:235100046-235100068 AAAAATGCTGGCAATTAAAAAGG + Intergenic
923952120 1:238968042-238968064 AAAAGTGCTGATAAAGAAAAAGG + Intergenic
1064412805 10:15122133-15122155 AAAAATTCTGATATTGAGAAAGG - Intronic
1064530208 10:16301011-16301033 AAAAAAGATTATAATTATAATGG - Intergenic
1064842724 10:19613055-19613077 ATAAATGATGATAATCATGAAGG - Intronic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065574957 10:27108524-27108546 AATAATGATAATAATAATAATGG - Intergenic
1065625927 10:27628184-27628206 TAAAATACTGACAGTGATAATGG + Intergenic
1065795987 10:29308797-29308819 AAAAATACAGATAATAAAAATGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066308810 10:34174848-34174870 AAAAATAATGACACTGATAATGG + Intronic
1066425062 10:35300799-35300821 AAAAATAATAATAATAATAATGG - Intronic
1066809100 10:39301959-39301981 AAAAATGCCTACATTGATAAAGG - Intergenic
1066991282 10:42516626-42516648 AAATATGTTGAGAATGATGATGG - Intergenic
1067118155 10:43451555-43451577 AAAAATAATAATAATAATAATGG - Intronic
1067597487 10:47568507-47568529 AACAAAGCAGAAAATGATAAAGG - Intergenic
1067730544 10:48807598-48807620 AAAAATCCTAAAAATAATAAAGG - Intronic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068367865 10:56075574-56075596 AAAAATGATGATAATGATGATGG - Intergenic
1068631321 10:59301060-59301082 AGAAATGCTGGGAATGATACAGG + Intronic
1068982889 10:63079962-63079984 AAAAGTGATGATGATGATGATGG + Intergenic
1069121076 10:64570204-64570226 AATAATAATAATAATGATAATGG - Intergenic
1069338810 10:67386743-67386765 TGAAATACTGAGAATGATAAAGG + Intronic
1070178140 10:73989972-73989994 AAAAATGATAAGCATGATAAGGG + Intergenic
1071036266 10:81249700-81249722 AAAGATGATGATGATGATACAGG + Intergenic
1071208013 10:83306052-83306074 TAATATGTTGATGATGATAATGG - Intergenic
1071332047 10:84570544-84570566 AAAAATACAAATAATGTTAAAGG - Intergenic
1071393711 10:85200645-85200667 CAGAGTGATGATAATGATAATGG - Intergenic
1071460091 10:85885550-85885572 AAAAATGATGATAATACCAATGG + Intronic
1071512848 10:86275480-86275502 AAATATGCTGAAAGTGGTAAAGG + Intronic
1072093787 10:92156325-92156347 AAAAATGAAGATAATGATGTTGG + Intronic
1072135397 10:92540659-92540681 AATAATGATGATGATGATGATGG + Intronic
1072147016 10:92650668-92650690 CAAAAATCTGATATTGATAAGGG + Intronic
1072355041 10:94600937-94600959 ATAAAAGTTGATAATGAAAACGG + Intronic
1072394970 10:95029879-95029901 AAAAAGGACTATAATGATAAAGG - Intergenic
1072857729 10:98967159-98967181 CAAAAAGCTGATATAGATAATGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073260255 10:102184314-102184336 AAAAATGCTGATAATGGGTCAGG - Intergenic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1073686586 10:105760985-105761007 AAAAATGAATAAAATGATAATGG + Intergenic
1074391284 10:113060181-113060203 AAAAATGCATTTAGTGATAAAGG + Intronic
1075067229 10:119297324-119297346 AATTATGGTGATAGTGATAATGG - Intronic
1075151548 10:119937227-119937249 AAAAATACTTATAATGACAAAGG - Intronic
1075250750 10:120869620-120869642 ATAAATGCTGATACTTATTAAGG + Intronic
1077552444 11:3206779-3206801 GATAATGGTGATGATGATAATGG + Intergenic
1077775877 11:5270994-5271016 AAATATGAGGATAATGACAATGG - Intronic
1077872582 11:6274638-6274660 AAACATAATGATAATGATAATGG + Intergenic
1077955422 11:7014199-7014221 AAAACTACTGGCAATGATAAGGG + Intronic
1078343498 11:10520959-10520981 TACAATGCTGACATTGATAATGG + Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078553137 11:12294068-12294090 AAAAGTGCTGAGAATGGTAGAGG + Exonic
1078885811 11:15498708-15498730 ATAAAAGCTGATAATAATATTGG - Intergenic
1079154564 11:17932917-17932939 AAAAGTGCTCATGATGATAAAGG + Intronic
1079256936 11:18838682-18838704 AAAAATGCTGAAAACTCTAAAGG + Intergenic
1079269142 11:18966501-18966523 AAAAATGCTGCTCCTGAAAAGGG + Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1079896091 11:26120053-26120075 ATATTAGCTGATAATGATAATGG + Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080217911 11:29866746-29866768 AACAATGATGATAAAGATTATGG + Intergenic
1080720018 11:34839489-34839511 AATGATGCCCATAATGATAATGG - Intergenic
1081100203 11:38992413-38992435 AAAATTGCTGAGAAAGAAAAAGG - Intergenic
1081168413 11:39835669-39835691 AACAATGATGATAATAAGAAAGG + Intergenic
1081563792 11:44243459-44243481 AAAAATGATGAAAATTATGAAGG + Intronic
1081591437 11:44425943-44425965 AAAAAGGCAGAGAATGAGAATGG + Intergenic
1081737355 11:45413346-45413368 AAAATTCCTCATAATGACAAAGG + Intergenic
1081830668 11:46110221-46110243 TAAAATGGGGATAATAATAAGGG - Intronic
1082018126 11:47508018-47508040 TTAAATGGTCATAATGATAAAGG - Intronic
1082225222 11:49698077-49698099 AAAAATAATGATAATAATAATGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1084443398 11:69189249-69189271 GGTAATGATGATAATGATAATGG - Intergenic
1085258007 11:75187809-75187831 AGAAATGATGATGATGATTATGG + Intronic
1085813937 11:79715755-79715777 AATAATGCTGATAATAAACATGG + Intergenic
1086953600 11:92914619-92914641 AATGATGATGATATTGATAAAGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087549835 11:99635141-99635163 AAAAATACTGAAAATTAAAAAGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1087946036 11:104161812-104161834 AAAAATGTTAATATTCATAATGG - Intronic
1088004954 11:104928130-104928152 AAAAATGCTGAAAACGCAAAAGG + Intergenic
1088158582 11:106840173-106840195 AAAAATGATGATATTGTTATTGG + Intronic
1088604813 11:111518504-111518526 CCAAATGGTGATAATCATAATGG - Intronic
1090500154 11:127253279-127253301 AAAAATAATAATAATAATAAGGG - Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090639001 11:128714636-128714658 AATAATGATGATGATGATGATGG + Intronic
1091256337 11:134189766-134189788 AAAGTTACTTATAATGATAAAGG - Intronic
1091482321 12:845713-845735 AATAATGATGTTGATGATAATGG - Intronic
1091686829 12:2568298-2568320 AAAAAAACTGAAAATCATAAGGG + Intronic
1092354279 12:7781841-7781863 AAAAATAATAATAATAATAATGG + Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1092858518 12:12697959-12697981 AAAAATGCAGATAAAGTGAATGG + Intergenic
1092951884 12:13511521-13511543 AAAAATGCTGACCATGAACATGG + Intergenic
1093567948 12:20631109-20631131 AAAAATGCCGGTAAAGATAAAGG - Intronic
1093819613 12:23597629-23597651 GGAAGTGATGATAATGATAATGG + Intronic
1093874105 12:24328749-24328771 AGTAATGATGATAATAATAAAGG - Intergenic
1093947133 12:25121981-25122003 AAAAATTCTCATACTGGTAAAGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094647616 12:32341560-32341582 ATAAATGGTGAGAATTATAAAGG - Intronic
1094766996 12:33608508-33608530 AAAAATGTGGAGAAAGATAAGGG - Intergenic
1095287677 12:40434491-40434513 ACTAATGTAGATAATGATAATGG + Intronic
1095320269 12:40818756-40818778 AAAAATGCTGAAAACCAAAAAGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095610141 12:44118450-44118472 TCAACTGCTGAAAATGATAAAGG + Intronic
1096277304 12:50220472-50220494 AAAAATGCTGATTATGTGTAAGG - Intronic
1096456108 12:51788466-51788488 AAACATGTTGAAAATGGTAATGG - Intronic
1096903818 12:54914126-54914148 AGAAATGCTGCAAATGCTAAAGG - Intergenic
1096999366 12:55863256-55863278 AATAATAATAATAATGATAAAGG + Intergenic
1097265251 12:57740613-57740635 AATAATGATAATAATAATAAAGG - Intronic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097346310 12:58497223-58497245 AAAAATGATAATAATAATAACGG + Intergenic
1097451813 12:59745396-59745418 TACAATGATGATAATGACAATGG + Intronic
1097487688 12:60226326-60226348 AAAAATGCTCAAAGAGATAAAGG + Intergenic
1097532255 12:60817831-60817853 AAAAATGATAATAAGCATAAAGG + Intergenic
1097582082 12:61470760-61470782 CAAAATGTTCATTATGATAACGG + Intergenic
1097605741 12:61751373-61751395 AAAAATGCTGCTTGTGAAAATGG - Intronic
1097815606 12:64070113-64070135 ATAAATGTTTATAATGAGAAAGG - Intronic
1097841068 12:64321815-64321837 CAAACTGCTGAAAATAATAAAGG - Intronic
1097963942 12:65559172-65559194 AATAATAATGATAATAATAATGG - Intergenic
1098110472 12:67116559-67116581 AAAAATTCAGATAATGAAATAGG - Intergenic
1098596577 12:72279398-72279420 AGAAATGATGATGATGATGATGG - Intronic
1098611071 12:72458881-72458903 AATAATGGTAATAATTATAAAGG + Intronic
1098896949 12:76073940-76073962 GAAAATGCTGAGCATGATAATGG - Intronic
1098938677 12:76509662-76509684 AAAAATGATGATGATAATAATGG + Intronic
1099149077 12:79086177-79086199 AACAATGATGATGATGATGATGG - Intronic
1099307676 12:80978164-80978186 AAAAATGCTGATTCTGATGGGGG + Intronic
1099383139 12:81980232-81980254 AAAATTCCTGATCATGATAATGG - Intergenic
1099473895 12:83084512-83084534 AAAAAAGATAATAATGATGATGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099706031 12:86153902-86153924 AAAAATGCTCACAATAAGAATGG - Intronic
1099875458 12:88399675-88399697 AAACATGATGATGATGATAAAGG - Intergenic
1099968834 12:89480062-89480084 AAATATGGTGATAATGGTACAGG - Intronic
1100077071 12:90798240-90798262 AAAAATCCTGAAAAGGACAAAGG - Intergenic
1101035309 12:100700005-100700027 AAAAATAATAATAATGATAATGG - Intergenic
1101049183 12:100843251-100843273 ATTGATGCTGATAATGATTATGG - Intronic
1101057078 12:100928743-100928765 AAAAAGGCAAATAATGATGATGG - Intronic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1101894773 12:108748041-108748063 AAAAATAATAATAATAATAAGGG - Intergenic
1102063708 12:109954906-109954928 AAAAATAATAATAATAATAAAGG + Intronic
1102181429 12:110915431-110915453 AAAAATGCAGAAAAGTATAAAGG - Intronic
1102669590 12:114606308-114606330 AATAATGATGATAATGATGGTGG - Intergenic
1103226741 12:119294272-119294294 AATAATGATGATGATGATGATGG - Intergenic
1103413693 12:120730297-120730319 GAAAATGCTGATGGTGAGAAAGG + Intronic
1104027654 12:125040286-125040308 AAAAATAGTGTTAATGAGAACGG - Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104295504 12:127508271-127508293 AAAGACGCTTATAATTATAATGG - Intergenic
1104777068 12:131396399-131396421 AATGATGCTGATGATGGTAATGG + Intergenic
1104777437 12:131399202-131399224 AATGATGGTGATGATGATAATGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105634027 13:22200014-22200036 AAAAATGGTGATGGTGATGATGG + Intergenic
1106037341 13:26055886-26055908 AATAGTAATGATAATGATAATGG + Intergenic
1106232726 13:27833790-27833812 AAAAATGGGGATAATAATAGTGG - Intergenic
1106421337 13:29588840-29588862 AAAACTGCTGAAAAAGAAAAGGG + Intronic
1106612773 13:31299565-31299587 AAAAAGGCAGAGACTGATAATGG - Intronic
1106972515 13:35159529-35159551 AAAAATGAAGAAAAGGATAATGG + Exonic
1107112135 13:36709567-36709589 AAAAATGCTGAACAGGAAAAAGG + Intergenic
1107591746 13:41914966-41914988 AAAAATCTTGAAAATGATTATGG - Intronic
1107708301 13:43128523-43128545 AAAAATGGAGATAATAATAATGG - Intergenic
1107847914 13:44537084-44537106 AAAAATGCACTTACTGATAATGG - Intronic
1108085300 13:46783184-46783206 AAAAGTGCTGATAGTGAGAGAGG - Intronic
1108113597 13:47103571-47103593 AAAAATGCTGAAAATCCAAAAGG + Intergenic
1108279830 13:48850425-48850447 AAAAATGGTGAGAAAGAGAAAGG - Intergenic
1108474000 13:50795391-50795413 ACAAATGCAGTTGATGATAAAGG + Intronic
1108977018 13:56458705-56458727 CTCAATGATGATAATGATAATGG + Intergenic
1109182470 13:59230408-59230430 TAAAATGGGGAGAATGATAACGG - Intergenic
1109278525 13:60329099-60329121 AACAATGTTGCTACTGATAAAGG - Intergenic
1109316522 13:60755737-60755759 AAAAATAGTAATATTGATAACGG + Intergenic
1109350043 13:61168442-61168464 AAAAATGGACATAATTATAATGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109451463 13:62520066-62520088 CAAAATGCTGAGAAAGAAAATGG + Intergenic
1109487254 13:63042444-63042466 AAAAATGCTGATAGTCTTTATGG + Intergenic
1110049493 13:70876735-70876757 AAAAAAGCTTAGAAGGATAAGGG + Intergenic
1110381398 13:74855685-74855707 GACAATGGTGATAATGATAATGG + Intergenic
1110591670 13:77269635-77269657 AAAAAATGTGCTAATGATAAAGG + Intronic
1110711673 13:78657361-78657383 ACAAATGGTAATAATGATAGAGG + Intronic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1110842624 13:80159771-80159793 AAAAATTCTGATCATGAAAATGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111921214 13:94413129-94413151 AAAATTGCTGAAAAGGAGAAGGG - Intergenic
1112062864 13:95758628-95758650 AAAAAAGTTAATAATAATAATGG + Intronic
1112076260 13:95916456-95916478 AAAAATGCTGAAAATTCAAAAGG + Intronic
1112204903 13:97315469-97315491 ATCAATACTGATATTGATAATGG + Intronic
1112270083 13:97960406-97960428 AAAAATACTGTGAATGATAGGGG + Intronic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1112863657 13:103866814-103866836 AAAAATGCAGACCATGATTATGG - Intergenic
1112893166 13:104264056-104264078 TAAATTTCTGCTAATGATAATGG - Intergenic
1113321056 13:109232573-109232595 AAAAATGCTGTGAATTCTAAAGG + Intergenic
1113344520 13:109463120-109463142 AAATATGCTGATACTTATATTGG + Intergenic
1113615013 13:111674138-111674160 GAAGATGCTAATAATAATAATGG + Intergenic
1113620482 13:111759052-111759074 GAAGATGCTAATAATAATAATGG + Intergenic
1113697914 13:112360788-112360810 AAAAATAATAATAATAATAATGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115042987 14:28954801-28954823 CATAATACTTATAATGATAATGG + Intergenic
1115935711 14:38549832-38549854 ACATATGCTGATTGTGATAATGG - Intergenic
1116295990 14:43110625-43110647 AAAATTGCTTAAAATGAAAAGGG + Intergenic
1116341199 14:43725587-43725609 AAATATATTGATAATAATAATGG + Intergenic
1116450366 14:45058177-45058199 AGAAGGGATGATAATGATAAGGG - Intronic
1116618500 14:47168794-47168816 TAAAATGCTAATAAGGCTAATGG + Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117597387 14:57337259-57337281 AAAATGACTGATAATGTTAATGG - Intergenic
1117951997 14:61091985-61092007 AAAAATGGTGACGATGAAAAAGG - Intergenic
1118096430 14:62542309-62542331 AATACTGCTAATAATTATAATGG - Intergenic
1118190837 14:63578700-63578722 AATGATGATGATAATGATGATGG - Intergenic
1118229029 14:63930516-63930538 AAAAAGAAGGATAATGATAAAGG - Intronic
1118399272 14:65364542-65364564 AAGAATGCTGAGAACGATAAGGG - Intergenic
1118402631 14:65393950-65393972 AATAATAATAATAATGATAAGGG - Intergenic
1119581124 14:75782172-75782194 AAAAATAATAATAATAATAAGGG - Intronic
1119720865 14:76889307-76889329 AAAAATAATAATAATAATAAAGG - Intergenic
1119896965 14:78228492-78228514 AAAAATAGTAATGATGATAATGG + Intergenic
1120623517 14:86795094-86795116 ATAAGTCCTGTTAATGATAATGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120799874 14:88676000-88676022 CAAAATGCTGATGATGACACAGG - Intronic
1121586553 14:95066978-95067000 ACAAATGATGATAATAATGATGG - Intergenic
1122250740 14:100437632-100437654 AATAATACTAATAATAATAATGG - Intronic
1122360455 14:101157893-101157915 AAAAATAATAATAATAATAATGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123189280 14:106552427-106552449 GGAAATGCTCATAATGATCAAGG - Intergenic
1123805438 15:23867318-23867340 AAAAATAATAATAATAATAATGG - Intergenic
1124009587 15:25826814-25826836 AATAATGATGATAATGATAATGG + Intronic
1124144313 15:27109015-27109037 ACAAATGCTCATAATAATATAGG - Intronic
1124281862 15:28368409-28368431 AAAAATAATAATAATAATAAAGG - Intergenic
1124300841 15:28543192-28543214 AAAAATAATAATAATAATAAAGG + Intergenic
1124781514 15:32640834-32640856 AAAATTGCTGTAGATGATAATGG + Intergenic
1124801217 15:32834654-32834676 AAAATTGCTGAAAATAATAACGG - Intronic
1124825738 15:33093563-33093585 AACACTGCTGAGAATGAAAATGG - Intronic
1125295508 15:38198618-38198640 AAAAATGCTGATACTGTGACTGG - Intergenic
1125332609 15:38597035-38597057 AAAAAAGATGAGCATGATAATGG + Intergenic
1125453342 15:39831882-39831904 TAAAATACTGAGAGTGATAAGGG - Intronic
1125790635 15:42363014-42363036 GATAATGATAATAATGATAAAGG + Intronic
1126000993 15:44209795-44209817 AAAGATGATGATAATGACAATGG - Intergenic
1126076459 15:44915657-44915679 AAAAATTCTGATAAAGCTCAAGG + Intergenic
1126123080 15:45270784-45270806 AAAAATAATAATAATAATAATGG - Intronic
1126127514 15:45309126-45309148 AAAAATAATAATAATAATAATGG + Intergenic
1126510693 15:49469882-49469904 AGAAATGGTGATAAAGAGAATGG + Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126679716 15:51191261-51191283 AAAATTGCTGATTATGGCAAAGG - Intergenic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126831676 15:52613549-52613571 AAAATTGATCATAATCATAAAGG - Intronic
1126855623 15:52836720-52836742 AAAAATAATAATAATAATAATGG - Intergenic
1126888219 15:53175371-53175393 AAAAATAATGATGATGATAATGG + Intergenic
1126955573 15:53929970-53929992 ACAAAGGCTGAAAATGACAATGG + Intergenic
1127000912 15:54503652-54503674 AGAAATGCTGATAATGAGTTTGG - Intronic
1127420588 15:58801404-58801426 AAAAAAGATGATAATTATATAGG + Intronic
1127590337 15:60416094-60416116 AAAAATGCCGATAATGGGAAAGG - Intergenic
1128318956 15:66679506-66679528 AAAGATAATGATGATGATAAAGG + Intronic
1128575496 15:68771731-68771753 GACATTGCTGAGAATGATAATGG - Intergenic
1130396518 15:83507406-83507428 AAAAATAATAATAATAATAAAGG - Intronic
1130409847 15:83637076-83637098 AACAATGCTACTAATAATAAAGG - Intergenic
1130760938 15:86819024-86819046 AAAAAGGCATATAATGGTAAAGG - Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131240629 15:90739402-90739424 AAAAATATTAATAATAATAAAGG + Intronic
1131410816 15:92206719-92206741 AAAAAGTCATATAATGATAAAGG - Intergenic
1131486517 15:92825420-92825442 AAAAATAATAATAATAATAAAGG - Intergenic
1131569800 15:93523371-93523393 AAAATGGCAAATAATGATAAAGG + Intergenic
1131657674 15:94478504-94478526 AAAAATGCTGAAATTGATACTGG - Intronic
1131887499 15:96933215-96933237 AATGATGATGATAATAATAATGG - Intergenic
1132125521 15:99220752-99220774 AAAAGTGATGATGATGGTAATGG - Intronic
1133149569 16:3817606-3817628 AAAACTCCTGATATTGAAAAGGG + Intronic
1133430298 16:5731143-5731165 GAAGATGATGGTAATGATAATGG - Intergenic
1133595725 16:7289475-7289497 AACGATGATGATAATCATAATGG - Intronic
1133876177 16:9736857-9736879 AAAGATGCTGATGTTGAGAATGG - Intergenic
1133910398 16:10060646-10060668 AAAGATGATGATAATGAAGATGG - Intronic
1133987464 16:10679482-10679504 AACAATGATGATAATGATGATGG - Intronic
1134491410 16:14698393-14698415 AAAAATAATAATAATAATAATGG + Intergenic
1134496791 16:14737511-14737533 AAAAATAATAATAATAATAATGG + Intronic
1134595955 16:15496119-15496141 GATAATGGTGATAGTGATAATGG + Intronic
1134679491 16:16114318-16114340 AATAATAATGATGATGATAATGG - Intronic
1134808143 16:17143225-17143247 GAAAATGGTGATGATGGTAATGG - Intronic
1135132883 16:19867431-19867453 TAAAATGCTCAGAATGATACCGG + Intronic
1135235041 16:20747268-20747290 AATAATTATGAGAATGATAAGGG - Intronic
1135260302 16:20974816-20974838 AAAAATAATAATAATAATAAGGG - Intronic
1135479212 16:22807637-22807659 AAAAATGTTCAGCATGATAATGG + Intergenic
1135506818 16:23045207-23045229 AAAAAGGCAGATAATAACAAGGG - Intergenic
1135820498 16:25681090-25681112 AAAAATGCATAAAATTATAATGG - Intergenic
1135878126 16:26224545-26224567 AAAAATAATAATAATAATAAGGG + Intergenic
1136157609 16:28394579-28394601 AGAAATGCTGATGATGGAAAGGG + Intronic
1136205478 16:28720705-28720727 AGAAATGCTGATGATGGAAAGGG - Intronic
1136375761 16:29864141-29864163 AAAAATAATAATAATAATAAAGG - Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1136695074 16:32072021-32072043 TAAAATGCTCATCATGATCAAGG + Intergenic
1136795574 16:33015280-33015302 TAAAATGCTCATCATGATCAAGG + Intergenic
1136874348 16:33839096-33839118 TAAAATGCTCATCATGATCAAGG - Intergenic
1137043237 16:35633153-35633175 AAAAATGCAGAAAATGTTTAGGG - Intergenic
1137368356 16:47880869-47880891 AACAATGATGATGATGACAATGG - Intergenic
1137529065 16:49265382-49265404 GAAAATGGAGATAATAATAATGG - Intergenic
1138405243 16:56787688-56787710 AGGAATGCTGGTCATGATAAAGG + Intronic
1138923595 16:61563857-61563879 TAAAATGCTGAATATGACAAAGG - Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139129605 16:64125650-64125672 AAAAATAATAATAATAATAAGGG - Intergenic
1139210591 16:65072980-65073002 AATGATGATGATAATGATCAAGG - Intronic
1139555233 16:67704406-67704428 TAAAATGAAGATAATAATAATGG - Intronic
1139919686 16:70451445-70451467 AATAATGACGATAATCATAATGG + Intergenic
1140103262 16:71937048-71937070 AATAATGATGATGATGATGATGG - Intronic
1140678227 16:77355795-77355817 AATGATGATGATAATGATGATGG - Intronic
1140993626 16:80239092-80239114 AAAAATACTGAGAATGAAAAAGG - Intergenic
1141754263 16:85980838-85980860 AACAATGATGATGATGATGATGG - Intergenic
1141813647 16:86393892-86393914 AATGATGGTGATAGTGATAATGG - Intergenic
1141813656 16:86393972-86393994 AATGATGGTGATAATGATGATGG - Intergenic
1203097829 16_KI270728v1_random:1276944-1276966 TAAAATGCTCATCATGATCAAGG + Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1144026066 17:11276762-11276784 AAAAATGATGATGATGATGATGG - Intronic
1144267458 17:13585069-13585091 ATAAATGCTGGTAATGAGGATGG - Intronic
1146171806 17:30640261-30640283 ACAGAAGCAGATAATGATAAAGG - Intergenic
1146345261 17:32056286-32056308 ACAGAAGCAGATAATGATAAAGG - Intergenic
1146675405 17:34770112-34770134 AATAATGATGGTAATGATGATGG + Intergenic
1147530793 17:41275401-41275423 AACAATGCTGATGATGAGACGGG + Intergenic
1148649670 17:49240714-49240736 AAAAATAGTGAGAATGACAAAGG - Intergenic
1148890329 17:50802452-50802474 AACAAGCCTGAGAATGATAATGG - Intergenic
1149216291 17:54358184-54358206 CAAAATGCTGATAAGCATTATGG - Intergenic
1149280372 17:55098001-55098023 TATAATGATGATGATGATAATGG - Intronic
1149308571 17:55372602-55372624 CAAAATACTGATAATGAATATGG + Intergenic
1149337161 17:55647547-55647569 AAAAATGCTCATAATAATAAAGG + Intergenic
1149352715 17:55807998-55808020 AATAATGATGATAATGATGGTGG + Intronic
1149501470 17:57156097-57156119 AAAAATAATGATAATAATACAGG - Intergenic
1149674955 17:58451095-58451117 AATAATGATGATGACGATAAAGG + Intronic
1150206379 17:63411831-63411853 CAAAATGCTGTTAAAGATCAAGG + Intronic
1150318536 17:64190210-64190232 AAAAATGCTAAACATGAAAACGG - Intronic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1151524301 17:74653410-74653432 AAAAATTCTGTTACTGAAAAGGG + Intergenic
1151701590 17:75745576-75745598 AAAAATAATAATAATAATAAAGG + Intronic
1152502691 17:80723487-80723509 ATAAATAATGATAATAATAATGG - Intronic
1153512124 18:5867260-5867282 AAAAATGCAAATAATTAAAAAGG + Intergenic
1153748266 18:8202731-8202753 AAAAATGCTTAAAAGGATGATGG - Intronic
1153800219 18:8662177-8662199 GAAAATGATGAAAATGAAAATGG + Intergenic
1154015954 18:10617573-10617595 AATAATAATAATAATGATAAGGG + Intergenic
1154053635 18:10989098-10989120 AAAAACACTAATAATAATAAAGG + Intronic
1154189556 18:12218070-12218092 AATAATAATAATAATGATAAGGG - Intergenic
1154340336 18:13497584-13497606 AAAAATGGTAATAATTAAAAAGG - Intronic
1155244189 18:23891619-23891641 CAAAATGATGTTAAGGATAAGGG + Intronic
1155783439 18:29869445-29869467 AAAAATGCAAAGAATTATAAGGG + Intergenic
1156093804 18:33504825-33504847 AAAAATAGTGATAATAACAAAGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156900980 18:42299994-42300016 AAAAATAATCATAATAATAAAGG - Intergenic
1157712652 18:49860416-49860438 TAAAATGGTGATAATGATGCTGG + Intronic
1157803438 18:50639514-50639536 GAAAATGCAGAAAATTATAAAGG + Intronic
1157955594 18:52094115-52094137 AAAAATAGTAATAATAATAAGGG - Intergenic
1158286163 18:55885940-55885962 AATAATGCAAATAATGAAAATGG + Intergenic
1159011083 18:63058925-63058947 AAAATTGCTGCTCATGAAAATGG + Intergenic
1159109434 18:64040009-64040031 AATAATGATAATAATGGTAATGG + Intergenic
1159361279 18:67406776-67406798 AAAAATGCTTACATTTATAATGG + Intergenic
1159418713 18:68186302-68186324 AAAAATAATGCTAATGAAAAAGG - Intergenic
1159451929 18:68613540-68613562 GATGATGGTGATAATGATAAGGG - Intergenic
1159527691 18:69614367-69614389 AAAAATGCTAATGAAAATAAAGG - Intronic
1159540724 18:69771902-69771924 CAAAATGATGACAAAGATAAAGG + Intronic
1159647886 18:70941415-70941437 AAAAATACACATACTGATAAGGG - Intergenic
1159687395 18:71439366-71439388 AAAAATGTTAAGAGTGATAAAGG + Intergenic
1159799975 18:72886485-72886507 AAAAATGGTGCTAATTATACAGG + Intergenic
1160099563 18:75907408-75907430 AAAAATGCTTTTAATTATGAAGG + Intergenic
1160143180 18:76344242-76344264 AATAATGGTGATAGTGATGATGG + Intergenic
1160768185 19:817996-818018 AATCATGCTGATAATGAAAGTGG - Intronic
1162901610 19:13798446-13798468 AAAAGTGATAATAATGATTAAGG - Intronic
1162990647 19:14299891-14299913 ACAGAAGCAGATAATGATAAAGG + Intergenic
1163278929 19:16303246-16303268 AAAAATAATAATAATAATAATGG + Intergenic
1163841920 19:19616675-19616697 AAAAATAATAATAATAATAAAGG - Intronic
1164699552 19:30274966-30274988 AAAAATCCAGAAAATTATAAAGG - Intronic
1164790984 19:30980573-30980595 AATGATGATGATAATGATGATGG - Intergenic
1165154709 19:33779976-33779998 AAAAATGGGGAGGATGATAACGG - Intergenic
1165293997 19:34911437-34911459 AAGAATGGTGATAGGGATAAGGG + Intergenic
1165455912 19:35910340-35910362 AATAATGATAATAATAATAAAGG + Intergenic
1165504370 19:36215504-36215526 GAAAGTGCTGATAATTATAACGG + Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166427506 19:42692675-42692697 AATGCTGCTGATAATGATCATGG + Intronic
1167106824 19:47435241-47435263 AATAATCCTGATTATGACAACGG - Intronic
1167683632 19:50941752-50941774 AATAATGATGATGATGATGAAGG - Intergenic
1168301959 19:55410027-55410049 AATAATGATGATAATACTAATGG + Intergenic
1168322692 19:55519322-55519344 AATAATGCTGATGATCATGAGGG + Intergenic
1168338917 19:55612924-55612946 TAAAATGAGCATAATGATAAGGG - Intronic
1168360448 19:55735442-55735464 AAATATGCAGATAAAGAGAAAGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925205353 2:2001157-2001179 AAAAAAACTAATAGTGATAAAGG - Intronic
925551542 2:5081031-5081053 AAAAATCCTAATAATTAAAATGG - Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925734539 2:6949925-6949947 AATAATGGTGATGATGATAGTGG - Intronic
925734540 2:6949940-6949962 AAAAATAATAATAATAATAATGG - Intronic
926155505 2:10451579-10451601 AATAATAATAATAATGATAAGGG - Intergenic
927258399 2:21061070-21061092 AATAATGATGATAATAATAGGGG + Intergenic
927409363 2:22806848-22806870 AAAAATGCTGACAATTACATGGG - Intergenic
927622100 2:24672181-24672203 AAAAATGCTTAAAATGATTATGG + Intronic
928633181 2:33215143-33215165 AATAATAATAATAATGATAATGG + Intronic
928657540 2:33468191-33468213 ATAAATGCTGATGAGCATAAAGG + Intronic
928720014 2:34109535-34109557 AAATATGATGACATTGATAAAGG - Intergenic
928801924 2:35105462-35105484 AAAAAAGCTGATCATGCTCATGG + Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930221599 2:48751884-48751906 GAAAATGCTAATAATAATTATGG - Intronic
930249243 2:49017084-49017106 TAAAATGCTGATATTTATCAAGG + Intronic
930464316 2:51726561-51726583 AAAAATACTTATAATAGTAATGG - Intergenic
930691177 2:54366734-54366756 AAAAATACTGAAAGTAATAATGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
930990716 2:57650728-57650750 AAAAAAGCACATAATGCTAAAGG + Intergenic
931235978 2:60413001-60413023 AAAAATAATAATAATAATAAGGG + Intergenic
931325284 2:61215705-61215727 AATGATGATGATAATGATAATGG + Intronic
931510035 2:62981536-62981558 AAAAATCCTATTAATGATATGGG + Intronic
932610111 2:73192515-73192537 AAAAATGGTAATAATAATAATGG - Intergenic
932756264 2:74412086-74412108 AAAAATAATAATAATAATAAAGG + Intergenic
932989608 2:76770699-76770721 AAAAATGCTGAATATGTAAAAGG - Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933213158 2:79595009-79595031 ATAATTGCTGATATTGATCAAGG + Intronic
933233603 2:79838708-79838730 AAAAGTGTTGATTATGATAGTGG + Intronic
933304515 2:80580711-80580733 AAAAATCCTAATAATAATGATGG + Intronic
933359517 2:81261846-81261868 AATGATGATGATAATGGTAATGG + Intergenic
933529065 2:83482822-83482844 AATAATGATGATGATGATAATGG + Intergenic
935509319 2:103951495-103951517 AAAAATGTGGATGATGAAAATGG + Intergenic
935932507 2:108143313-108143335 AGAAATTCTGATATAGATAAAGG + Intergenic
936126132 2:109790320-109790342 AAAAAAGATAATAATAATAAGGG + Intergenic
936218561 2:110581148-110581170 AAAAAAGATAATAATAATAAGGG - Intergenic
936583784 2:113732685-113732707 AATGATGATGATTATGATAATGG + Intronic
936606103 2:113956048-113956070 AAAAATAATAATAATAATAAAGG - Intronic
936739281 2:115485652-115485674 AAATATGCAGAAATTGATAAAGG + Intronic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936868101 2:117100312-117100334 AAAACTAATGTTAATGATAAAGG + Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937196365 2:120160742-120160764 AAAAATGCTCAAAATCATCAGGG - Intronic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
937783887 2:125872670-125872692 AAAACTACTTAAAATGATAAAGG + Intergenic
938115266 2:128598288-128598310 AAAGGTGGTGATAATGATAGTGG - Intergenic
939271664 2:139947299-139947321 AAAAATGATGACAATGATGATGG + Intergenic
939340650 2:140892173-140892195 AAATATGATGAAAATGATTATGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939841251 2:147189752-147189774 AAACCTGCTGATAATCATATGGG - Intergenic
939925250 2:148164873-148164895 AAAATGGCTGAAAATAATAAAGG - Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940389757 2:153118520-153118542 AAAAAGGCTAATAATAATAGTGG - Intergenic
940435062 2:153641672-153641694 ACAGAAGCTGATAATCATAAGGG - Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940841795 2:158592096-158592118 AGGAATGATGATAATGATAATGG - Intronic
941001658 2:160208852-160208874 ACAAATGCTGAGAAAAATAAAGG + Intronic
941135013 2:161704719-161704741 ACAAAAGATGTTAATGATAAAGG - Intronic
941248918 2:163137128-163137150 AAAAATGATAATAAAGATGAAGG - Intergenic
941322651 2:164074499-164074521 AAATATGGTTATAATAATAATGG + Intergenic
941541097 2:166785602-166785624 AAAAATGTTAATAGAGATAAGGG + Intergenic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941650911 2:168091755-168091777 CAAAATGTTGATAATGTTGAAGG - Intronic
941888981 2:170558312-170558334 AAAAATGCTTAAAACGAAAATGG + Intronic
942296516 2:174523113-174523135 AATAATGATGATGATGATGATGG - Intergenic
942631985 2:177960143-177960165 AATAATGATGAAAAAGATAATGG - Intronic
942762541 2:179416575-179416597 AAAAATAATAATAATGATAACGG + Intergenic
943174381 2:184451171-184451193 AAAAATGCAGATAAGGACAAAGG - Intergenic
943224739 2:185157004-185157026 AAAAATCCTGCTAATTGTAAAGG + Intergenic
943338616 2:186649800-186649822 AAACATGTTAATAATGATAATGG - Intronic
943476192 2:188358641-188358663 AAAAACTCTGATAAGTATAAAGG + Intronic
943529390 2:189060068-189060090 ATGAATGATGATAATGATGAAGG - Intronic
943668954 2:190640104-190640126 AGAAATGCTCATAATGTTATGGG - Intergenic
943808085 2:192148967-192148989 AAAAATGCTGAAAATGCTGTGGG - Intronic
944103062 2:196049990-196050012 AAATATGCTTTTATTGATAATGG - Intronic
944352249 2:198742560-198742582 ATAAAAGCAAATAATGATAAAGG + Intergenic
944548552 2:200823102-200823124 AAAATTGTTGAAAATGTTAAAGG + Intronic
945238577 2:207655523-207655545 AAGCATGATGATTATGATAATGG - Intergenic
945445825 2:209937126-209937148 TAAAATGAAGGTAATGATAATGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945727661 2:213492814-213492836 AAAAGTAATGACAATGATAATGG + Intronic
946007716 2:216539809-216539831 AAAAATGGTGATGATAATGATGG + Intronic
946554361 2:220838173-220838195 GAAAATGCTGCTATAGATAATGG + Intergenic
946713357 2:222528486-222528508 AAAAATGCTAACAATGATCTGGG + Intronic
946950955 2:224874431-224874453 TAAAATGGTGATAATACTAAGGG - Intronic
947161071 2:227215140-227215162 AAAAATGATGATGATGAGACTGG - Intronic
947270950 2:228334470-228334492 ATTAATGCTGATAATTATTAGGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947491711 2:230601518-230601540 AATAATAATAATAATGATAATGG + Intergenic
947882565 2:233531633-233531655 AACTATGCTGTTAATGAAAAAGG - Intronic
948686348 2:239672183-239672205 AAAAATGTTGATCATGACAGTGG - Intergenic
948774015 2:240271200-240271222 AAACTTTCTCATAATGATAAAGG - Intergenic
948963964 2:241361866-241361888 AAAAATAATAATAATAATAAAGG - Intronic
1169166306 20:3427232-3427254 AAATATGCTGATAAGAAAAAAGG - Intergenic
1169417693 20:5431944-5431966 ATAAATGTTGAAAATGATGAGGG - Intergenic
1169792266 20:9423886-9423908 AAAATTGTTGGTAGTGATAATGG - Exonic
1169951754 20:11052364-11052386 AAAAATGGTGATAATAATAAGGG - Intergenic
1170132386 20:13034796-13034818 AAAAATGCTGTTATAGATGATGG + Intronic
1170215931 20:13891292-13891314 AAATCTGCTGATAATGTTACAGG - Intronic
1170278642 20:14621114-14621136 AAAAATGAGGATAATAATACTGG + Intronic
1170390579 20:15868697-15868719 TACTATGCAGATAATGATAAGGG - Intronic
1170522181 20:17198165-17198187 AGTGATGATGATAATGATAAGGG + Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171332500 20:24352920-24352942 AAAAATTTTGGTAATGATAAGGG - Intergenic
1171332666 20:24355084-24355106 AAAGATGCTTAAAATGCTAAAGG - Intergenic
1171905654 20:30897474-30897496 AAAAATACTGAAAATGTAAAGGG + Intergenic
1173184142 20:40827661-40827683 AGAAATGATGATGATGATAATGG + Intergenic
1173240808 20:41295384-41295406 AAAAATGCTTACAATGACATGGG + Intronic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173968906 20:47135451-47135473 AATAATGTTGATAATGATAATGG - Intronic
1174126006 20:48306923-48306945 AATAATAGTGATAATAATAATGG + Intergenic
1174126222 20:48308797-48308819 AAAACTTCTGATGATGTTAAAGG + Intergenic
1174217169 20:48925149-48925171 AAAAATTGTGATAATCATGATGG + Intronic
1174235761 20:49090130-49090152 AAAAATAATAATAATAATAACGG + Intronic
1174699750 20:52596246-52596268 AAGAGTGCTGATAAAGAAAAAGG + Intergenic
1174939626 20:54911098-54911120 AAAAATGCTCAACATGATCAGGG - Intergenic
1174953439 20:55067732-55067754 AAAAATTCTAATAATGAGGAGGG - Intergenic
1175041711 20:56058312-56058334 TAAAATGATGTTAATGGTAATGG - Intergenic
1175526452 20:59637944-59637966 CAAAATGGGGATAATAATAATGG - Intronic
1175668925 20:60884729-60884751 AGTAATGATGATAATGATAATGG + Intergenic
1175728728 20:61337348-61337370 AACAATGGTGATGATGATGATGG + Intronic
1176258043 20:64163417-64163439 TAACATCCTGATTATGATAATGG + Intronic
1176655606 21:9586804-9586826 AATCATGGTGATGATGATAATGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177957086 21:27611704-27611726 CATAGTGCTGATAATGGTAATGG - Intergenic
1177974752 21:27833664-27833686 AATAATTCTGATAATAGTAATGG + Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178091191 21:29164945-29164967 AAAAATGCTTATAATATTTACGG - Intronic
1178169900 21:30028656-30028678 AGAAATGCTGATAATCAAATTGG + Intergenic
1178508145 21:33179928-33179950 AAAAATGCTTATTATGATAGAGG + Intergenic
1179083183 21:38192389-38192411 TAAAATTCAGAGAATGATAAAGG - Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179439866 21:41385998-41386020 AAAAATACAAATAAAGATAAGGG + Intronic
1180339062 22:11603571-11603593 AAAAATACTGAAAATGTAAAGGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181312668 22:21953605-21953627 AAAAATAATAATAATAATAAGGG - Intergenic
1182090173 22:27589263-27589285 AACAATGATGATGATGATGATGG - Intergenic
1182679449 22:32067337-32067359 AAAAATAATAATAATAATAATGG - Intronic
1183105862 22:35614734-35614756 AATGATAATGATAATGATAATGG - Intronic
1183367689 22:37415967-37415989 AAAAATAATAATAATGATGATGG + Intronic
1184349896 22:43936671-43936693 AAAAATGGAGATGATGATAGTGG + Intronic
1184634910 22:45819934-45819956 AAAAATCCTGACAATTATCAGGG - Intronic
1184908934 22:47512733-47512755 AATAATGATGATGATGATGATGG + Intergenic
1185078837 22:48698199-48698221 AATAATGATGGTGATGATAATGG + Intronic
949228412 3:1721358-1721380 AAAAATGCCTAGAATGAAAAGGG - Intergenic
949466027 3:4344585-4344607 AAAAATGCTGAAAATCCAAAAGG + Intronic
949760802 3:7468301-7468323 AAAAGAGCTGATAATTATGATGG - Intronic
949762438 3:7486268-7486290 AGAAATGATGGTAATGATAATGG + Intronic
949872439 3:8600589-8600611 AATGATGGTGATAATGATGATGG - Intergenic
949946878 3:9196706-9196728 AAATATGCAGAAAATAATAAAGG + Intronic
950237662 3:11337640-11337662 AAAAATAATAATAATAATAAAGG - Intronic
950849197 3:16045877-16045899 AAAAATGCTGATAATGTATTTGG - Intergenic
950889928 3:16394965-16394987 AATCATGCTGGTGATGATAAAGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951189050 3:19748261-19748283 ACAAAAGTTGAAAATGATAAAGG - Intergenic
951437707 3:22684261-22684283 TATAATGCTGATAATTATACAGG - Intergenic
951451637 3:22846425-22846447 AAAGATGCTGATGATTATGATGG + Intergenic
951791135 3:26486019-26486041 AAAAATACAGATAAAGAAAAAGG + Intergenic
951918413 3:27826426-27826448 AAAAGTGCTTAAAATGATGATGG + Intergenic
952130963 3:30362486-30362508 AGAAATGCTCAAGATGATAAGGG + Intergenic
952429649 3:33210527-33210549 ATAAATCCAGAGAATGATAAAGG - Intronic
952627307 3:35422191-35422213 AAATATGCTGTTCATGATCAGGG - Intergenic
952648559 3:35693532-35693554 AAAATTGCTGACAATGATTCAGG - Intronic
952973928 3:38677977-38677999 AAAATTTCTGATAATGACATGGG + Intergenic
955899898 3:63741456-63741478 AGAAATGCTGTTGATGATAGAGG - Intergenic
955959203 3:64321558-64321580 AGAAATGTTGATAATAATAATGG - Intronic
957291465 3:78282362-78282384 AAAAATGCTGAAAATCCAAAAGG + Intergenic
957434017 3:80151406-80151428 AAAAATGCTGAAAATCCAAAAGG - Intergenic
957498249 3:81018407-81018429 AAATATGCTGATAATATTTATGG - Intergenic
957571470 3:81951958-81951980 ATAAATGCTGCCAATAATAAAGG - Intergenic
957584220 3:82113961-82113983 AAAAATGCTGAAAATCCAAAAGG - Intergenic
957773621 3:84727046-84727068 AAAAATGCCCATGAAGATAATGG + Intergenic
957855309 3:85868890-85868912 AAAAATGGAGATGAAGATAAAGG - Intronic
957864774 3:86007291-86007313 AAAAATGATTATAACAATAATGG + Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958435337 3:94089172-94089194 AAAAGTGCTGCAAAGGATAATGG - Intronic
958680359 3:97322406-97322428 AAAAGTACTGCTAATGAAAATGG + Intronic
958787062 3:98608903-98608925 AAAATTTGTGAGAATGATAAGGG - Intergenic
958975211 3:100659762-100659784 AACATTGCTGATGAGGATAATGG - Exonic
958979658 3:100706685-100706707 AAAAATCCTAAGAATGAAAACGG - Intergenic
958995984 3:100905482-100905504 ACTTATGCTGAAAATGATAAAGG + Intronic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959166501 3:102785761-102785783 AAAAGTGCTGTTAATGAAACTGG - Intergenic
959221444 3:103525737-103525759 ATAAATGAGGATAATGAAAAGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959345385 3:105187864-105187886 ATAAAGGCTGATATTGAAAAGGG + Intergenic
959362567 3:105411982-105412004 AAAAAATCTCATACTGATAAGGG + Intronic
959526566 3:107383949-107383971 ATAAATGGTGATAATGATACTGG + Intergenic
959843898 3:111010513-111010535 GAAAATGCAGATAAAGAAAATGG + Intergenic
960355284 3:116644951-116644973 AAAATTGTTGAAAATGTTAAAGG - Intronic
960738835 3:120810542-120810564 AAAAATAATGATAATGAAAAGGG + Intergenic
960822398 3:121749081-121749103 AATAATCCTGCTAATGCTAATGG - Intronic
961089343 3:124096227-124096249 AAAAGGGGTGATGATGATAATGG + Intronic
961198450 3:125024213-125024235 AGAAATGTTGAGAATCATAATGG - Intronic
961872018 3:129995567-129995589 AAAAATGATGATAAGCTTAAGGG - Intergenic
962508903 3:136078624-136078646 AAAAATGAAGAGAATAATAAGGG + Intronic
962680466 3:137794387-137794409 AATAATGATGATAATAATAATGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963715233 3:148795420-148795442 AAAACTGCTTCTAATGACAAAGG - Intronic
963951242 3:151204381-151204403 AAAGATGCTTATGATGATATTGG + Intronic
964080244 3:152745545-152745567 AAAAATGCTGATATTCTGAAGGG - Intergenic
964124425 3:153221401-153221423 AACAATTATGATAATAATAAAGG - Intergenic
964228196 3:154431614-154431636 AGAAATGATGATAATAATAGGGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964882625 3:161441162-161441184 AAAAATATTAATAATCATAATGG - Intergenic
964911389 3:161785606-161785628 ACAAATGCTGGTGAGGATAAAGG - Intergenic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965265854 3:166542359-166542381 TAAAATGGTGATAATGAAAAAGG + Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965583240 3:170291695-170291717 AAAAATAATAATAATAATAAAGG + Intronic
965794437 3:172424919-172424941 AAAATTGTTGACAATGTTAAAGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967677778 3:192320245-192320267 AAAAAATCATATAATGATAAAGG + Intronic
967727720 3:192877455-192877477 AAAAATTCAGATATTGTTAAAGG - Intronic
967864965 3:194182466-194182488 AAAAAAGCTGAGAAGGAGAAAGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969218416 4:5742646-5742668 AAAAATGATGCTCATGATGATGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970416546 4:15863412-15863434 GATAATGATGATAATGATGATGG - Intergenic
970505138 4:16721503-16721525 AAAAATGATGCTAATTTTAATGG - Intronic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970968466 4:21954107-21954129 TAAAATGATGATAGTGATTAAGG - Intergenic
971181207 4:24330018-24330040 CATGATGATGATAATGATAAGGG - Intergenic
971516756 4:27496866-27496888 AAAATTGCTGAAAATGCAAAAGG + Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971556352 4:28016956-28016978 AAAAATGATGATGATGAAAAAGG + Intergenic
971895323 4:32585706-32585728 AAAAATGCTTATACTAATTATGG - Intergenic
971901950 4:32671472-32671494 AAAAATATTGATAATGGAAATGG + Intergenic
971990547 4:33887122-33887144 AAATATGATGATGATGATGATGG + Intergenic
972083894 4:35188629-35188651 ATAAATGCATATGATGATAAGGG - Intergenic
972193858 4:36628736-36628758 AAAAATAATAATAATAATAATGG + Intergenic
972340130 4:38145353-38145375 AAAAATGCTGTGATGGATAATGG + Intergenic
972366548 4:38380832-38380854 AAGAATATTAATAATGATAATGG + Intergenic
972858230 4:43134251-43134273 ACAACTACTGATAATAATAATGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
972955431 4:44384164-44384186 ACAAATGCTGGTGAGGATAAAGG + Intronic
973119967 4:46509879-46509901 AAAAATGCAGACAATTCTAAAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973795697 4:54423968-54423990 AATAATGATAATAATAATAATGG - Intergenic
973898331 4:55439561-55439583 AATAATGCTGCTTATGATTATGG - Intronic
974185089 4:58435211-58435233 AGAGATGCTGATACTGATATTGG - Intergenic
974451097 4:62061165-62061187 AAAAATGTTAAAAATGAGAAGGG - Intronic
974460208 4:62177941-62177963 AAAATTGCTCATAATCTTAAGGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
974756618 4:66217454-66217476 AAAAATAAGGATAATGGTAAAGG + Intergenic
974809790 4:66931149-66931171 AAAGATGCTAGTAATGACAATGG + Intergenic
975320424 4:73004246-73004268 TAAAATGCTGGTAAAAATAAAGG - Intergenic
975507262 4:75151299-75151321 AAAAATGCTGGTGAGGATATAGG - Intergenic
975587028 4:75960065-75960087 GAGAATGCTGAAAATGATGAAGG - Exonic
975817268 4:78231337-78231359 GAAAATACAGATAAGGATAAAGG + Intronic
975931131 4:79524379-79524401 AAAAATGTTGCTTTTGATAAGGG - Intergenic
976287660 4:83385769-83385791 AGAAATGCTGATGATGACTATGG - Intergenic
976327105 4:83784194-83784216 AATAATGGTGATAAAAATAAGGG + Intergenic
977374173 4:96180240-96180262 AATAATAATGATAATAATAATGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977724915 4:100284897-100284919 AAAATTGCTAATAATGTTTAAGG + Intergenic
978407853 4:108398740-108398762 AACAATTCTGATAATCATCAAGG - Intergenic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
979089311 4:116460099-116460121 AATAATGCTGTTACTCATAAAGG + Intergenic
979882574 4:125980233-125980255 GGAGATGCTGATAATGAGAAAGG + Intergenic
979959195 4:126995901-126995923 AATAATAATAATAATGATAAAGG - Intergenic
980113940 4:128661347-128661369 ATAATTGATGATAATGATCACGG + Intergenic
980393670 4:132179205-132179227 AAAAATAATAATAATAATAAGGG + Intergenic
980479670 4:133371774-133371796 AAAAGTGCTGAAAATAAGAAGGG - Intergenic
980509470 4:133766239-133766261 ACAAATGCAGATAATGAATATGG - Intergenic
980552866 4:134362629-134362651 AAAAAGGTTGAAAATGCTAAAGG + Intergenic
980977944 4:139628975-139628997 AAATATAATGATAATAATAAAGG - Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981581881 4:146257627-146257649 AACAATGATGATAATAATTATGG + Intronic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982617892 4:157664603-157664625 AAAAACGCTGATATTGCCAAAGG + Intergenic
982622105 4:157721493-157721515 GAAAATAATAATAATGATAATGG - Intergenic
982943781 4:161592269-161592291 AATAATGATAATAATAATAATGG - Intronic
982992524 4:162296532-162296554 AGAAATGCTGAGAATTAAAAAGG - Intergenic
983013244 4:162576610-162576632 AAAAATGTTGATAGTGGTAGAGG + Intergenic
983118391 4:163849360-163849382 AAAGATGATGATAATAATGATGG - Intronic
983313360 4:166094672-166094694 AAAAATTCTCAGAATAATAAAGG - Intronic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983849175 4:172559035-172559057 AAGGATGATGATAATGATAATGG + Intronic
984002411 4:174266246-174266268 AAAAATAATAATAATAATAATGG + Intronic
984098435 4:175460285-175460307 AATAATGATGATTATAATAAAGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984302122 4:177934346-177934368 AAAAAGGTTGAAAATAATAAAGG - Intronic
984464893 4:180085599-180085621 AAAAATGCCCTTAATGATTAAGG - Intergenic
985132540 4:186753421-186753443 ATAAATGATGTTAATTATAAGGG + Intergenic
985166918 4:187105780-187105802 AAAAATGATGCTAATTAAAAAGG + Intergenic
985375269 4:189330392-189330414 AAAAATACTAAAAATGTTAATGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
985978804 5:3445631-3445653 AGAAATGATGATGATGATGATGG + Intergenic
986382630 5:7202108-7202130 AAAAATGTTCAGAATGATATTGG - Intergenic
986509413 5:8488260-8488282 AAAAATAATTATAATTATAATGG - Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987147875 5:15010474-15010496 AATAATAATGATAATGATACAGG + Intergenic
987241057 5:15999975-15999997 AAAAAAGCTGCAAATGAAAATGG - Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987613777 5:20245640-20245662 AAAAATGCTCATAAAGTTGAAGG + Intronic
987923966 5:24317050-24317072 AAAAAGGCTGAAAATTACAAAGG - Intergenic
987970887 5:24942074-24942096 AATAATGATGATGATAATAATGG - Intergenic
987978561 5:25048169-25048191 AAAAATAATAATAATAATAATGG + Intergenic
987981568 5:25091977-25091999 AAAAATGAGGATTATAATAATGG - Intergenic
988020200 5:25611292-25611314 AAAAATAATAATAATGATAATGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988109076 5:26791967-26791989 AGAAATGCAGAGAATCATAAGGG + Intergenic
988440064 5:31223910-31223932 AATGATGGTGATAATGACAATGG + Intronic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989107782 5:37879750-37879772 GAGAATGATGATAATGGTAATGG + Intergenic
989711163 5:44399138-44399160 AAAAATGATGAAAATGAAATTGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991924688 5:71693340-71693362 AAAAAGACTCAAAATGATAAAGG - Intergenic
992321959 5:75622318-75622340 AAAAATGCAGATTCTGATTAAGG - Intronic
992410170 5:76497694-76497716 AACAATGCTGAGAATTATATGGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993070309 5:83153619-83153641 AAAAATAGTGATGATGACAAAGG + Intronic
993082660 5:83320749-83320771 AAAAATGCTAATAATCATCTGGG - Intronic
993269542 5:85776473-85776495 AAAAATGGTGATAATAATGTTGG + Intergenic
993353949 5:86882736-86882758 AAAAATGGGGATGATAATAATGG - Intergenic
993659567 5:90615849-90615871 AAAAGTTGTGAAAATGATAAAGG - Intronic
993695720 5:91059360-91059382 AAAAATACTGGTAATAATGAAGG - Intronic
993956606 5:94242320-94242342 AAGCATGCTGATAGTGGTAATGG - Intronic
994180091 5:96754620-96754642 AAACATGCTAACAATGAAAATGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994468612 5:100171938-100171960 AAGAATGATGATATTGTTAAAGG + Intergenic
994472778 5:100230368-100230390 ACAAGGGCTGATAATGAGAATGG - Intergenic
994626364 5:102225134-102225156 AGAAATTCTGATAAGGAAAATGG - Intergenic
994765712 5:103914622-103914644 AGAAATGCTGAAAATGTAAAAGG + Intergenic
994843048 5:104951127-104951149 AAAAATGCTGAAAATTCAAAAGG - Intergenic
995006949 5:107210086-107210108 AAAAATTTTGTGAATGATAAAGG + Intergenic
995164273 5:109020240-109020262 AAAAATGCTGATCTTGCTCAAGG - Intronic
995682333 5:114733458-114733480 AAAATTGCTGAAAATGAACATGG + Intergenic
995685237 5:114765676-114765698 AAAAATGCTGAAAACCAAAAAGG - Intergenic
995969499 5:117950839-117950861 GAAAATTTTGATAATGAGAAGGG + Intergenic
996083768 5:119283321-119283343 AACAATGATGAAAATGATCAAGG + Intronic
996122086 5:119684024-119684046 TAAAATGGTGATAATACTAATGG + Intergenic
996204838 5:120720271-120720293 AAGAATGATGAAAATGAAAAAGG - Intergenic
996215729 5:120862764-120862786 AAAAATGGTGGTAATTAAAATGG + Intergenic
996347989 5:122508290-122508312 TAAAATGGAGATAATGATAATGG - Intergenic
996584599 5:125071195-125071217 AAACATGCAAATACTGATAAAGG + Intergenic
996639195 5:125731331-125731353 AAAAATGCTGAAAATGCAAAAGG + Intergenic
996703275 5:126471195-126471217 AAAAATTCTTATAAGGAGAATGG - Intronic
997959928 5:138312810-138312832 GAAAATGGTTATGATGATAAAGG + Intronic
998258292 5:140606997-140607019 AAAAATAATAATAATAATAATGG + Intergenic
998424979 5:142018829-142018851 TAAAATGGGGATAATCATAATGG + Intergenic
998752890 5:145342924-145342946 AGAAAGTCTTATAATGATAAAGG + Intergenic
998818948 5:146041173-146041195 AAAAATGGGGATAATGACCATGG + Intronic
999762172 5:154710992-154711014 AAAAATTCTGAAAATGAAAGTGG + Intergenic
1000014097 5:157262675-157262697 AATAATGATAATAATAATAATGG - Intergenic
1000186709 5:158865526-158865548 AAATTTGATGATGATGATAATGG + Intronic
1000342455 5:160288107-160288129 AAAAATAATAATAATAATAAAGG - Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000788141 5:165571317-165571339 GAAAATGTTGATAATGATGTGGG - Intergenic
1000876331 5:166643029-166643051 AGAAAAGCTGATAATGGAAAAGG - Intergenic
1001149617 5:169215874-169215896 AAATATTATGATGATGATAAAGG - Intronic
1001528017 5:172442699-172442721 ATAAATGATGATGATGATGATGG + Intronic
1002376356 5:178791930-178791952 AATGATGATGATGATGATAAGGG + Intergenic
1003411760 6:5870402-5870424 ACTAATGATGATGATGATAAAGG - Intergenic
1003932385 6:10937705-10937727 AAAAAAACTGTTAATGAAAAAGG + Intronic
1004282092 6:14288833-14288855 AAAAATGTAGGTAATGAAAATGG - Intergenic
1004451405 6:15751148-15751170 CAAAATGTTGAAAATGACAAAGG - Intergenic
1004545058 6:16589706-16589728 AACAATACTGATAGTGATAATGG - Intronic
1004581377 6:16957095-16957117 ATATATGCTGATAATAACAATGG + Intergenic
1004789514 6:19008691-19008713 AAAAATGGTGATAAGTAAAAGGG + Intergenic
1004813214 6:19282943-19282965 AAAAATGCTCATAATAAATAAGG - Intergenic
1006234838 6:32620336-32620358 AAAAATGCTGGTAAGGAGGAGGG + Intergenic
1006946339 6:37786968-37786990 AAAAATAATGATAAAAATAAAGG + Intergenic
1006987564 6:38186350-38186372 AATAATGATGATTATTATAAGGG + Intronic
1007909129 6:45495650-45495672 AAAACTGTAGATAATGATCATGG + Intronic
1008142608 6:47849324-47849346 AAAAATAGTAATAATGGTAATGG + Intergenic
1008557800 6:52691799-52691821 AACAGTGCTAATAATAATAATGG - Intergenic
1008662965 6:53687592-53687614 ATAAATGGTGATAATTACAATGG - Intergenic
1008740451 6:54600747-54600769 AAAAATTCTGATAATTAACATGG - Intergenic
1009006246 6:57792205-57792227 AAAAATAATGATAAGAATAAGGG + Intergenic
1009008231 6:57812875-57812897 AATAATAATAATAATGATAAGGG + Intergenic
1009051968 6:58286770-58286792 AAAAATGATGATGATGATGATGG - Intergenic
1009567589 6:65330659-65330681 AATAATGTTGATGATGTTAACGG - Intronic
1009608812 6:65909612-65909634 AAAAATACTGATAACAATAAGGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009638849 6:66303880-66303902 AAAATTGCTGATAATATTATAGG + Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1009796635 6:68477742-68477764 AAAAATGCTGTTAATTGAAAGGG - Intergenic
1009892093 6:69697613-69697635 ATAACTTCTGATAATCATAAAGG - Exonic
1010496742 6:76542221-76542243 AAAAATCATCATAATAATAACGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010668420 6:78656268-78656290 AAAAAAGCTGAAAAAGATCAGGG - Intergenic
1010753981 6:79645518-79645540 GAAAATGGTGAGAATGATGAGGG - Intronic
1011070576 6:83377190-83377212 AAAAGTGATGATTATGATGATGG + Intronic
1011819454 6:91234356-91234378 TAAAATGCAGATGATGATATTGG - Intergenic
1011894921 6:92213865-92213887 AATAATGATGATGATGACAATGG - Intergenic
1011895522 6:92219915-92219937 AAAAATACAGAAAAAGATAAGGG - Intergenic
1011992766 6:93544366-93544388 AAAATAGCTGATAATGACAAAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012304678 6:97638898-97638920 AAAAATAATAATAATAATAAAGG - Intergenic
1012535916 6:100296697-100296719 AAGGATGTTGATAATGAGAAGGG + Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012652068 6:101767357-101767379 CAAAATGTTTATAATGGTAATGG - Intronic
1012670412 6:102038510-102038532 AGAAATGCAGATTATGATAGTGG - Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012803508 6:103866405-103866427 AAAAATGCAAATAACTATAAAGG - Intergenic
1013181404 6:107719728-107719750 TAAAATTGTGATAATAATAATGG - Intronic
1013364005 6:109421545-109421567 GAAGATGATGATAATGAGAAGGG - Intronic
1013746788 6:113355375-113355397 AATAATAATGATAATGATAATGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014662006 6:124184236-124184258 AGAAAGGCTGATAGTGAAAAAGG - Intronic
1014698904 6:124658596-124658618 TAAAATGCTGATGATAACAAAGG - Intronic
1014709214 6:124786807-124786829 AAAGATGCTTAGAATAATAATGG - Intronic
1014960510 6:127678200-127678222 AAAAAGACCGATAATGATATTGG - Intergenic
1015000336 6:128206375-128206397 ATACATGCTGCTAATAATAAAGG + Intronic
1015043119 6:128745483-128745505 AAAAATGGAGATAAAGATTAGGG - Intergenic
1015080347 6:129217193-129217215 AAAAATAATAATAATAATAAGGG + Intronic
1015101031 6:129480789-129480811 AAAAATGCAGACACAGATAATGG + Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015304821 6:131696100-131696122 AAAGATGATGATGATGAAAATGG - Intronic
1015398116 6:132757980-132758002 AAAAATGATGATAAAGTAAAAGG - Exonic
1015448060 6:133331410-133331432 AATAATGCTGATGATGACACAGG - Intronic
1015652303 6:135477388-135477410 TAAAAAGCCAATAATGATAATGG - Intronic
1015714313 6:136175268-136175290 AATAATAATGATTATGATAATGG - Intronic
1015828290 6:137339491-137339513 TAAAATCCTGATGATGTTAAAGG - Intergenic
1015915487 6:138212025-138212047 CAAAATGCTTAAAAAGATAAGGG + Intronic
1015990842 6:138940986-138941008 AAAAATGTTTATAATGAAGATGG + Intronic
1016042677 6:139447525-139447547 AATCATGATGATCATGATAATGG - Intergenic
1016153740 6:140777664-140777686 AAAAATTCTGAAAATAATAGAGG + Intergenic
1017264850 6:152431470-152431492 AAAAATACTGATAACTATTAAGG + Intronic
1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG + Intronic
1018234087 6:161705795-161705817 AGAAATGCAGAGAATGAGAATGG - Intronic
1018840931 6:167516045-167516067 AATGATGGTGATAATGATAATGG - Intergenic
1018913742 6:168120075-168120097 AAAAATAATGATGATGATAATGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019353459 7:566344-566366 GAATATGGTGATGATGATAATGG - Intronic
1019824285 7:3270748-3270770 GATAATGATGATGATGATAATGG + Intergenic
1020471323 7:8538498-8538520 TAAAATGAGGATAAAGATAATGG + Intronic
1020790667 7:12624691-12624713 AAGAATAGTGATAATAATAATGG - Intronic
1020921181 7:14266514-14266536 AAAAATGTTTATAGTTATAAAGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021109411 7:16677009-16677031 AAATCTGCTGATCATGGTAAAGG - Intronic
1021365982 7:19778202-19778224 AAGAATGCTGAATATCATAAAGG + Intergenic
1021435557 7:20610541-20610563 AACAATGCTAAAAATAATAATGG + Intergenic
1021744036 7:23720580-23720602 AAAAATACTGAAAATGTAAAGGG + Intronic
1021762869 7:23918297-23918319 AACAATGCAGATAAAGATGATGG - Intergenic
1022100208 7:27164904-27164926 AACAATGCTGAGAATGAGAGCGG - Exonic
1022948760 7:35315688-35315710 ATAAGTGGTGATATTGATAATGG + Intergenic
1023066913 7:36387642-36387664 AATGATGATGATAGTGATAATGG - Intronic
1023332609 7:39134439-39134461 ACAGATCATGATAATGATAATGG + Intronic
1023565404 7:41519326-41519348 AAAAATAATAATAATAATAATGG - Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024708591 7:51988888-51988910 AATAATGCTAATAATACTAATGG - Intergenic
1025089354 7:56049736-56049758 AAAAATAATAATAATAATAAAGG - Intronic
1026113262 7:67475336-67475358 AAAAATGATGATGATGTTCATGG + Intergenic
1026286451 7:68967721-68967743 AATGATGGTGATGATGATAATGG + Intergenic
1026467405 7:70666207-70666229 CAAAATGGGAATAATGATAATGG + Intronic
1027337269 7:77165033-77165055 AAAAGAGCTGATGATGATATTGG + Intronic
1027337444 7:77167893-77167915 AAGAATTTTGATAATGATATTGG - Intronic
1027493758 7:78861659-78861681 AAAAATAATGATAATGGTCAGGG + Intronic
1027521748 7:79217292-79217314 AAATATGCTGATGGTGACAAAGG + Intronic
1027559454 7:79709451-79709473 AAAAATATTGATAATGTTTATGG + Intergenic
1028661048 7:93275502-93275524 AAAAATGCTAATAATCATCTGGG - Intronic
1028883952 7:95910920-95910942 AAAAATAATGATCATGACAAAGG - Intronic
1028928601 7:96387985-96388007 AAATATGATGATATTGAAAAGGG - Intergenic
1029032866 7:97487464-97487486 AAAAAGGCAGATAATGAAGAGGG - Intergenic
1029200055 7:98833413-98833435 AATAATGATGATAATGATGTTGG - Intergenic
1029253528 7:99253435-99253457 AAAAATAATAATAATAATAAAGG + Intergenic
1029778298 7:102702905-102702927 AAGAATTTTGATAATGATATTGG + Intergenic
1029778529 7:102706087-102706109 AAAAGAGCTGATGATGATATTGG - Intergenic
1030340857 7:108378447-108378469 AAAAAGGTTGAGAATCATAAAGG + Intronic
1030376986 7:108763807-108763829 AATAATGCTTAGAATGATACAGG - Intergenic
1030434158 7:109494058-109494080 ATAAAAGTTGATAATGATGATGG + Intergenic
1030664890 7:112265678-112265700 AAAAATCATCATAATGTTAATGG + Intronic
1031073138 7:117184764-117184786 AAAAATGGTGAAAATGAACAAGG + Intronic
1031217340 7:118911989-118912011 ACAAATGCTGACAAAGATATGGG + Intergenic
1031226421 7:119043281-119043303 AAAAATCATGATAATTATATTGG - Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031428805 7:121639877-121639899 ATGTTTGCTGATAATGATAATGG - Intergenic
1032707027 7:134429981-134430003 TAAAATGGAGATAATGCTAATGG - Intergenic
1032995742 7:137444548-137444570 ACAAAAACTGGTAATGATAAGGG - Intronic
1033886942 7:145960901-145960923 AAAAATAATAATAATAATAAAGG - Intergenic
1034030666 7:147759602-147759624 AAGGATGCAGATGATGATAAAGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034679092 7:152914874-152914896 AATAATGGTGATGATGATGATGG - Intergenic
1034736835 7:153437058-153437080 AATAATGGTAATAATAATAATGG - Intergenic
1035347183 7:158209452-158209474 AAAGAAGGTCATAATGATAAAGG + Intronic
1035517328 8:247029-247051 AAAAATGCTGGTATTGACTAAGG - Exonic
1035868560 8:3111829-3111851 AAAAATAATAATAATAATAATGG + Intronic
1036971340 8:13358696-13358718 AAAAATGCTAACAAAGATAAAGG + Intronic
1037278513 8:17208554-17208576 ACACATGCTGATGATCATAAAGG + Intronic
1038799668 8:30738358-30738380 AAAAATAATAATAATAATAAAGG + Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039476205 8:37840635-37840657 AAAAATTCTGATAATTTAAAGGG + Intronic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040547610 8:48411421-48411443 AAAAATGCTGAAAGAGCTAAAGG + Intergenic
1040774004 8:51016695-51016717 AAAAATGCTAATAATCATGTGGG + Intergenic
1040929581 8:52719649-52719671 AAACATACTAATAATGATGATGG + Intronic
1041003091 8:53470969-53470991 AATAATCCTCATAATGATCATGG - Intergenic
1041057295 8:53999575-53999597 AAAATTGATGATATGGATAAAGG + Intronic
1041142581 8:54839033-54839055 AATAATGATGATGATGGTAATGG - Intergenic
1041876888 8:62698801-62698823 GAAAATGCTGAAAAAGATAATGG + Intronic
1042018445 8:64343293-64343315 AAAAGTGCTGATGATGATCAGGG - Intergenic
1042391771 8:68244239-68244261 TAAAATGCTTTTCATGATAAAGG + Intergenic
1042756333 8:72216650-72216672 AAATTTGCTGATAATCATATTGG - Intergenic
1043021205 8:75002496-75002518 AAAAATAATAATAATGATGAAGG + Intronic
1043576056 8:81657913-81657935 AAAAATAATAATAATGATAATGG + Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1043975111 8:86576006-86576028 GAAAATGAAGATAAAGATAAAGG - Exonic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044419122 8:91971210-91971232 AAAAATTATAATAATGATATAGG - Intronic
1044517678 8:93158047-93158069 AATAATGATAATAATGATGATGG - Intronic
1044638076 8:94347604-94347626 AAAAATGATGATAAACAAAATGG + Intergenic
1044816056 8:96114213-96114235 AAAATTACTGATAATTAAAAAGG + Intergenic
1044818317 8:96135864-96135886 AAAAATAATAATAATGATGATGG + Intergenic
1044928952 8:97233672-97233694 CCAAATACTAATAATGATAATGG - Intergenic
1045073337 8:98534660-98534682 AAATCTGCTGAAAATGTTAATGG - Intronic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1045229237 8:100285619-100285641 AAAAATTCTGACAATGATAAAGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046052208 8:109037433-109037455 AAAAATGAGAATATTGATAATGG - Intergenic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046390552 8:113567091-113567113 ATAAATAATGATAATAATAATGG + Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1046841622 8:118864966-118864988 GAAACTGGTGATAATGATGATGG - Intergenic
1046970778 8:120220884-120220906 AATAATGGTGATGATTATAATGG + Intronic
1047015143 8:120716267-120716289 AATAATCATGATAATAATAATGG - Intronic
1047801097 8:128311099-128311121 AGTAATGGTGATGATGATAAAGG - Intergenic
1047801099 8:128311150-128311172 AAAGATAATGATGATGATAAAGG - Intergenic
1047894564 8:129352301-129352323 TAATATGATGATACTGATAATGG + Intergenic
1048306227 8:133286670-133286692 AAAACTGCTGAGGATGATCACGG + Intronic
1048556770 8:135485693-135485715 AATAATGATGATAAAGATAAGGG + Intronic
1048690891 8:136961922-136961944 AACCATGGTGATAAGGATAATGG + Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048766522 8:137850498-137850520 AATAATAATGTTAATGATAAGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1049134265 8:140880712-140880734 AATGCTGCTGATCATGATAAAGG + Intronic
1049298802 8:141858615-141858637 ATCAATGGTGATAATGATGATGG - Intergenic
1049741116 8:144241492-144241514 AAAAATGTTGAGAATGCCAATGG - Exonic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050895025 9:10875987-10876009 AAAAATGGTGACAGTGATAAAGG + Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052361817 9:27570381-27570403 AAAAAGGTGGATAATCATAAAGG + Intronic
1052364435 9:27596155-27596177 AAAAATACTGATACTGTTATGGG - Intergenic
1052494037 9:29204066-29204088 AAGAATGCAGATGATGATTATGG + Intergenic
1052520194 9:29537388-29537410 GATAATGGTGATGATGATAATGG - Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1052873613 9:33533877-33533899 AATAATAATAATAATGATAATGG - Intronic
1052964281 9:34327844-34327866 AAAAATAATAATAATAATAAAGG + Intronic
1054946981 9:70805939-70805961 AGAAATGCTGCTAATGAGGAAGG + Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055599657 9:77902567-77902589 AAGAATGCTAAAAATAATAAAGG + Intronic
1056179965 9:84073137-84073159 AGAAAAGCTGTTAATGATCATGG - Intergenic
1056452136 9:86726633-86726655 AATGATGATGATGATGATAATGG - Intergenic
1056679883 9:88707758-88707780 GAAAATTCTGAGAAAGATAAAGG + Intergenic
1057246690 9:93461679-93461701 AAAAATATTAATAATAATAAAGG - Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057681874 9:97195276-97195298 AATAATAATAATAATGATAATGG + Intergenic
1058212928 9:102195214-102195236 GAAAACACTGAAAATGATAAAGG + Intergenic
1058657601 9:107237853-107237875 AATAATAATGACAATGATAAGGG - Intergenic
1058992120 9:110264213-110264235 AAAAATGCTGAGCATGGTAGTGG + Intergenic
1059498000 9:114726025-114726047 AGAATTGCTTATAATGATGATGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059632859 9:116143149-116143171 AAAATTGATGATGATGATGATGG - Intergenic
1059869149 9:118551708-118551730 AAAGATGCTTTTAATAATAAAGG - Intergenic
1060056082 9:120414118-120414140 AAAATTGATAATGATGATAAAGG + Intronic
1060334321 9:122706959-122706981 ATTAATGATGATAATGATGATGG - Intergenic
1203633319 Un_KI270750v1:90219-90241 AATCATGGTGATGATGATAATGG + Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1185683060 X:1904644-1904666 GATAATGGTGATAATGATGATGG + Intergenic
1185683091 X:1905043-1905065 AATGATGGTGATAGTGATAATGG + Intergenic
1185977271 X:4735446-4735468 AAAGATGATGATGATGATAGTGG - Intergenic
1186131656 X:6473224-6473246 GTAAATGATGATAATGATTATGG + Intergenic
1187822068 X:23298342-23298364 AATAATGGTGATAATGAACAAGG - Intergenic
1188051131 X:25487960-25487982 CAAGATGATGATGATGATAACGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188140884 X:26549232-26549254 AAAGATGCTGATAAAGGTGAGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189533666 X:41913363-41913385 AAAAATAATAATAATGACAATGG + Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189739785 X:44105995-44106017 AAAAACCCTGACAATTATAATGG + Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1190639020 X:52465081-52465103 ACAAATCCTAATAATGATGAAGG - Intergenic
1190839632 X:54132050-54132072 AAAAATAATAATAATAATAAAGG - Intronic
1190888557 X:54550175-54550197 AAAAGTGGTGATACTGAGAATGG + Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191969375 X:66796581-66796603 TAAAATGGGGATAATAATAATGG + Intergenic
1192207195 X:69104352-69104374 TAAAATGGTGATGATGATAATGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192666245 X:73089175-73089197 AAAATTTCTGATCATGGTAAAGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192894018 X:75421084-75421106 AAAAATGTTAAAAATGGTAAGGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193631592 X:83895447-83895469 AAAAATGTCACTAATGATAAAGG - Intergenic
1193744436 X:85258576-85258598 AATAATAATAATAATGATAATGG + Intronic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194627427 X:96242163-96242185 AAAAATGCAATTTATGATAAAGG + Intergenic
1194650383 X:96507548-96507570 TAAAATCCTGGTGATGATAATGG - Intergenic
1194699975 X:97102482-97102504 AACAATAATGTTAATGATAATGG - Intronic
1194898733 X:99479862-99479884 AAAAATGGTGCTAAAGAAAATGG + Intergenic
1195215356 X:102694657-102694679 AAATATGCTCAAAATGCTAAAGG + Intergenic
1195241995 X:102961096-102961118 GATGATGCTGATGATGATAATGG - Intergenic
1195255620 X:103086842-103086864 AAAAGAACTCATAATGATAAAGG + Intronic
1195470585 X:105225464-105225486 AATAGTGGTGATAATGTTAAAGG + Intronic
1195509524 X:105698173-105698195 AATAATGATGATAATGATAGTGG - Intronic
1195588243 X:106591724-106591746 TAAGATGCTGAAAATTATAAAGG - Intergenic
1196214845 X:113038431-113038453 AAAAATAATAATAATAATAAGGG - Intergenic
1196607235 X:117671070-117671092 AAAAATGCTGAAAACCAAAAAGG - Intergenic
1197133327 X:123031450-123031472 AAAAATGGTAATTATGACAAGGG - Intergenic
1197295499 X:124714014-124714036 ATAATTGCTGTTAATGATAATGG + Intronic
1197328146 X:125119814-125119836 AAAAATGAAGATGATGAAAATGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197673555 X:129305196-129305218 GAAAGTGATGACAATGATAAAGG + Intergenic
1197973884 X:132144501-132144523 AAAAATACTGATAAAAATTATGG + Intergenic
1198338570 X:135692028-135692050 AATGATGATGATGATGATAACGG - Intergenic
1198450356 X:136761563-136761585 AAAGATGCTAATAATGTTGAAGG + Intronic
1198636435 X:138706523-138706545 AAATATGCTGAAAATAATGAAGG + Intronic
1198733507 X:139760300-139760322 GAAAATGATGATAATGATGATGG - Intronic
1199505407 X:148555593-148555615 AGAAATGCTGATATTGCTGAGGG - Intronic
1199535695 X:148900455-148900477 AAATGTGCTGATAATGAGAGAGG + Intronic
1199538840 X:148934816-148934838 AACAATGATGATGATGATGATGG - Intronic
1199731997 X:150643426-150643448 AAAAATACTGATAAGCAAAAAGG + Intronic
1199870958 X:151898398-151898420 AAAAATATTGATAATGATGATGG - Intergenic
1200448227 Y:3290933-3290955 AAAAATAATAATAATAATAATGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201425309 Y:13843799-13843821 AAAAATTCTGATGCTAATAAAGG + Intergenic