ID: 911412211

View in Genome Browser
Species Human (GRCh38)
Location 1:97524056-97524078
Sequence ATACCGCAAAGGTGTCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911412209_911412211 -9 Left 911412209 1:97524042-97524064 CCTCTTGACAGAAGATACCGCAA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 911412211 1:97524056-97524078 ATACCGCAAAGGTGTCATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911412211 Original CRISPR ATACCGCAAAGGTGTCATGA AGG Intronic