ID: 911412211 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:97524056-97524078 |
| Sequence | ATACCGCAAAGGTGTCATGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 43 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 40} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 911412209_911412211 | -9 | Left | 911412209 | 1:97524042-97524064 | CCTCTTGACAGAAGATACCGCAA | 0: 1 1: 0 2: 0 3: 4 4: 65 |
||
| Right | 911412211 | 1:97524056-97524078 | ATACCGCAAAGGTGTCATGAAGG | 0: 1 1: 0 2: 0 3: 2 4: 40 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 911412211 | Original CRISPR | ATACCGCAAAGGTGTCATGA AGG | Intronic | ||