ID: 911412283

View in Genome Browser
Species Human (GRCh38)
Location 1:97524779-97524801
Sequence AGTTAGGGATAGAAATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911412283_911412291 15 Left 911412283 1:97524779-97524801 CCCCCAAATTTCTATCCCTAACT 0: 1
1: 0
2: 2
3: 20
4: 237
Right 911412291 1:97524817-97524839 ATTAGATTGTTGCAATCAGTTGG 0: 1
1: 0
2: 1
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911412283 Original CRISPR AGTTAGGGATAGAAATTTGG GGG (reversed) Intronic
901336227 1:8451477-8451499 AGATTGGGCTAGAAAATTGGTGG - Intronic
902165803 1:14570394-14570416 GGCTAGGGATAGGAATTGGGAGG - Intergenic
903393927 1:22984763-22984785 AGTTAGGGACAGAGATTCTGGGG + Intergenic
904377497 1:30090854-30090876 AGAGAGGGATGGAGATTTGGAGG - Intergenic
905310646 1:37046699-37046721 ATTTATGGATCGAAATTGGGGGG + Intergenic
908835476 1:68225159-68225181 AGTCAGGGATAGAATGTGGGGGG + Intronic
910803461 1:91167352-91167374 AGTGAGGGATAGATATTTGGTGG + Intergenic
911162199 1:94692301-94692323 TTTTAGGGATAGAAAATAGGTGG - Intergenic
911412283 1:97524779-97524801 AGTTAGGGATAGAAATTTGGGGG - Intronic
912570872 1:110620097-110620119 AGAGAGAGAGAGAAATTTGGTGG + Intronic
914464401 1:147913356-147913378 AGTAAGGGAAATAAATTTGGAGG + Intergenic
914787116 1:150844126-150844148 AGTTAATCATAGATATTTGGAGG - Intronic
916309197 1:163375711-163375733 AGGCAGGGATGGAAAATTGGGGG - Intergenic
916854838 1:168738661-168738683 AGTTAAGGGTAGAAAAATGGTGG - Intergenic
917830478 1:178879036-178879058 ACATAGGGATAGAAAGGTGGAGG - Intronic
917860422 1:179138557-179138579 AGTGAGAGAAACAAATTTGGAGG - Intronic
918024049 1:180725365-180725387 AGTAAAGGGTAAAAATTTGGGGG + Intronic
918087381 1:181257272-181257294 AGCTAGAAATACAAATTTGGTGG + Intergenic
918299482 1:183189553-183189575 AATTTGAGATATAAATTTGGGGG + Intronic
920908651 1:210193832-210193854 GGTTAGGGGTACAAATATGGGGG - Intergenic
921538139 1:216377966-216377988 AAGGAGGGAGAGAAATTTGGTGG + Intronic
923950297 1:238944033-238944055 AGTTAGGGATTAAAAGTTTGGGG - Intergenic
1063826226 10:9900783-9900805 AGTTTGGGAAAGAAATTTTGAGG + Intergenic
1063857838 10:10274712-10274734 TGTTAGAGATACAAATTTGGGGG - Intergenic
1066446006 10:35484217-35484239 AGTTAGGGATAGAATCATGTAGG - Intronic
1069367368 10:67707959-67707981 AGGTAGGGAGAGAAATTAGGTGG - Intergenic
1069960345 10:72075574-72075596 ATTTATGATTAGAAATTTGGGGG + Intronic
1073068427 10:100778343-100778365 AGTTAGTGCTGGAAACTTGGAGG - Intronic
1074197161 10:111199603-111199625 GGTTAGGGATATGAATTTTGGGG + Intergenic
1075276188 10:121094748-121094770 AATAAGGGATAGAATTTTGCAGG - Intergenic
1075405438 10:122192633-122192655 AATTAGGGGTGGGAATTTGGGGG + Intronic
1077432153 11:2521169-2521191 AGTTTGGGAGAGAAGTTTTGGGG - Intronic
1079151195 11:17901040-17901062 AGTAAGGGAAACAGATTTGGGGG - Intronic
1079327586 11:19507470-19507492 AATTTGGTATAGAAATGTGGAGG + Intronic
1079415033 11:20226090-20226112 AGTTAGGGGCAGAAAGTTGAGGG + Intergenic
1079635382 11:22732551-22732573 AAATAGGGATAGCAATTTAGGGG - Intronic
1079771876 11:24472784-24472806 AATTAAAAATAGAAATTTGGAGG + Intergenic
1079952029 11:26818092-26818114 AGTTAGGAAAACAAATTTCGGGG - Intergenic
1082696810 11:56377254-56377276 ACTCAGGGATAGAATTCTGGAGG + Intergenic
1083072499 11:60000156-60000178 AGTCAGGGATAGGAATCTGGAGG + Intergenic
1084036225 11:66512451-66512473 CATTATGGATAGGAATTTGGGGG - Intronic
1086944092 11:92828146-92828168 AGAAAGGGATAGCAATTTGAAGG + Intronic
1087010992 11:93513892-93513914 AGATAAGGAAAGACATTTGGCGG - Intronic
1087539556 11:99498495-99498517 AGTTAGGGAGAGGAAAATGGAGG - Intronic
1088366715 11:109047557-109047579 AGTTAGGTACACAACTTTGGCGG - Intergenic
1088652922 11:111974253-111974275 AGGTAAGGGTAGAAATCTGGGGG + Exonic
1089057444 11:115597550-115597572 AGAAAGGGAGAGAAATTTGGGGG - Intergenic
1089626052 11:119751718-119751740 AGCTAGGAAGAGAAATGTGGAGG - Intergenic
1090045097 11:123324578-123324600 ATTTGAGTATAGAAATTTGGGGG - Intergenic
1090430676 11:126643700-126643722 AGATAGGGAGAGGAGTTTGGAGG + Intronic
1091600758 12:1916461-1916483 AGGTAGGGATTGAAATTCTGAGG + Intronic
1094054152 12:26251544-26251566 ATCAAGGGATAGAAACTTGGGGG - Intronic
1094250195 12:28351035-28351057 AGTGAGGGACAGGAATTTTGTGG - Intronic
1096379443 12:51143473-51143495 AGTAGAGGATAGAAATTTAGAGG + Intronic
1096905574 12:54932360-54932382 GGTTAGGGGTCCAAATTTGGGGG + Intergenic
1097637259 12:62138033-62138055 AGTTTGTGATAGAGATATGGGGG - Intronic
1099587447 12:84537620-84537642 AGTTAGAGATTGAATTTTAGAGG + Intergenic
1099684697 12:85869662-85869684 AGTCAGAGATACAAACTTGGAGG + Intergenic
1099698043 12:86045577-86045599 ATTTAGTGATAAAAATTTGGGGG - Intronic
1101228075 12:102709653-102709675 CATTAGGGATTGCAATTTGGTGG + Intergenic
1102667916 12:114591926-114591948 AGTTGGGGATAAAGATTTGAGGG + Intergenic
1103411133 12:120711779-120711801 ATTTGGGGATGGAAATTTGGGGG + Intronic
1106254307 13:28008787-28008809 ATTTTGGTATATAAATTTGGGGG + Intronic
1106920341 13:34556505-34556527 AGTGATGGATACAAATGTGGTGG + Intergenic
1108017494 13:46091183-46091205 ATTTTGGTATAGATATTTGGGGG + Intronic
1108939314 13:55932497-55932519 AGTTTGGGATAGCACTTGGGAGG - Intergenic
1110646147 13:77886878-77886900 GGTTAGTGATATAAATGTGGAGG + Intergenic
1111653188 13:91118902-91118924 AATTAGGGATAGAAAAAGGGAGG - Intergenic
1111673820 13:91362343-91362365 ATTTAGAGATACAAATATGGGGG - Intergenic
1111746557 13:92277833-92277855 TGTTAGGCATAGAAATATGATGG + Intronic
1112025146 13:95404849-95404871 AGTGAGGAATATATATTTGGAGG - Intergenic
1112138832 13:96614981-96615003 AGTTTGGCATAGATATTTTGTGG + Intronic
1112366641 13:98761125-98761147 AGTTAGGAAAAGAAAACTGGAGG + Intergenic
1114692183 14:24594348-24594370 AGTTAGGAAAACATATTTGGGGG - Intergenic
1116769089 14:49106539-49106561 AAAGAGGGAAAGAAATTTGGAGG + Intergenic
1117516228 14:56504513-56504535 AGGAAGGGATAAAAAGTTGGAGG - Intronic
1118874503 14:69772219-69772241 AGATAGAGAAAGAACTTTGGGGG - Intergenic
1120275573 14:82369393-82369415 AGTTAGTTGTTGAAATTTGGTGG - Intergenic
1123144755 14:106117903-106117925 AGTGAGAGAAAAAAATTTGGAGG - Intergenic
1124127759 15:26952997-26953019 AGGTAGGGATTGCAAATTGGTGG + Intergenic
1125776182 15:42216473-42216495 AGTTTGCTATAGTAATTTGGTGG - Intronic
1126563068 15:50065977-50065999 ATTTAGGAATAGAAATTCAGAGG + Intronic
1127996845 15:64158040-64158062 AGCTAAGGATGGAGATTTGGGGG - Intronic
1129811518 15:78514672-78514694 AGTTAGGGCTATAATTTTGTTGG + Intronic
1131505232 15:93011951-93011973 TGTCATTGATAGAAATTTGGAGG + Intronic
1131732591 15:95297520-95297542 AGTGAGGGATAAAAATATAGTGG - Intergenic
1133515325 16:6503248-6503270 AGATAAGTATAGATATTTGGGGG - Intronic
1133530566 16:6651448-6651470 AAGTAGGGAGAAAAATTTGGGGG - Intronic
1134196641 16:12164063-12164085 AGTTGGGGAAAGCATTTTGGAGG + Intronic
1135652664 16:24219762-24219784 GCTTGGGGATAGAAATGTGGTGG - Exonic
1138779942 16:59771635-59771657 AGGTAGGGAAAGAAATTTCTGGG - Intergenic
1140547800 16:75827987-75828009 TATTAGGGATAAAAATTTGACGG - Intergenic
1141283605 16:82650927-82650949 AGTTGGGGTTTGAAATTTGCTGG + Intronic
1142936303 17:3335565-3335587 ATTTAGGAATAGAAAATTGATGG - Intergenic
1143805261 17:9421020-9421042 AGTTGGGGAAACGAATTTGGAGG - Intronic
1144466813 17:15503814-15503836 TGTTTGGGATAGAACTTCGGTGG - Intronic
1145404343 17:22571876-22571898 AGGTAGGGAAATAATTTTGGGGG + Intergenic
1146493014 17:33295657-33295679 AGGTAGGGATACAAATATGAAGG - Intronic
1146977398 17:37126261-37126283 AGATAAGGATCCAAATTTGGAGG + Intronic
1150505341 17:65692998-65693020 AGATAGATATAGACATTTGGAGG - Intronic
1151558012 17:74856460-74856482 AGAGAGAGAGAGAAATTTGGTGG - Intronic
1152211189 17:79004119-79004141 AGTTAGGGAGAGGAGTTGGGGGG + Intronic
1203174138 17_GL000205v2_random:179168-179190 AGTTAAGGCTAGATTTTTGGGGG - Intergenic
1156249164 18:35334697-35334719 AGATAATCATAGAAATTTGGGGG - Exonic
1159353962 18:67312620-67312642 AGTTAATCATAGCAATTTGGTGG + Intergenic
1159453906 18:68637498-68637520 AGTTTGGAAAACAAATTTGGGGG - Intergenic
1159495188 18:69193742-69193764 GGTTAGGGATAGAGATGTGCAGG + Intergenic
1164256917 19:23535272-23535294 ATTCAGGGAAAGAAATTTAGAGG + Intronic
1165493013 19:36136054-36136076 GGCTGGAGATAGAAATTTGGGGG + Intergenic
926991221 2:18682617-18682639 AGAGAAGGATAGAAATCTGGTGG + Intergenic
929617193 2:43320895-43320917 TTTTAAGTATAGAAATTTGGGGG + Intronic
929881755 2:45842918-45842940 AGTTTGGGGTAGAAATGTTGTGG + Intronic
930456143 2:51609926-51609948 AGAGAGGGATAGTAATTTTGAGG + Intergenic
930709302 2:54535006-54535028 ACTTAGGGAAAGAATTCTGGTGG - Intronic
931817394 2:65918291-65918313 AGCTTGGAATATAAATTTGGTGG + Intergenic
931954604 2:67407077-67407099 TGCTTCGGATAGAAATTTGGTGG - Intronic
932123421 2:69122051-69122073 AGTTATAGAAAGAACTTTGGTGG - Intronic
933326520 2:80844770-80844792 AGATAAGGATAGGCATTTGGAGG - Intergenic
933383131 2:81576538-81576560 TGTTAAAGATACAAATTTGGTGG + Intergenic
934621159 2:95808151-95808173 AATTAGGAAGATAAATTTGGTGG + Intergenic
934912878 2:98275377-98275399 AGTTAAGGAGATAGATTTGGAGG + Intronic
937584372 2:123528140-123528162 AGTCAAGGAGAGAAATTTGTTGG - Intergenic
939808433 2:146803849-146803871 AGCAAGAGATAGAAAATTGGTGG + Intergenic
942334367 2:174866507-174866529 AGTTAGGGAAAGGCATTTTGTGG + Intronic
944016980 2:195052383-195052405 GGTTAAGGTTAGAAATTTGGTGG - Intergenic
944157481 2:196622490-196622512 AGAGAGAGAGAGAAATTTGGAGG - Intergenic
944950650 2:204745108-204745130 ACTTAGTGATAGAAAGATGGAGG + Intronic
945535480 2:211012374-211012396 AATTGGGGATTGTAATTTGGGGG + Intergenic
946573009 2:221044896-221044918 AAGTAGGGAGACAAATTTGGAGG - Intergenic
946879233 2:224160856-224160878 AGGTAGGGAGAAAAATATGGTGG + Intergenic
1169555045 20:6740494-6740516 ACTTAGGGATGCCAATTTGGTGG + Intergenic
1170002679 20:11632588-11632610 AGTTAAGAATATAAAATTGGGGG + Intergenic
1170243322 20:14193935-14193957 AGATAGGGATGAAAATTTAGGGG + Intronic
1170852962 20:20020640-20020662 AGCTAAAGATGGAAATTTGGGGG + Intronic
1171416080 20:24981465-24981487 TGTTAGGGAGAGAGATGTGGGGG - Intronic
1173761164 20:45561915-45561937 AGTTAGGGAAATAATTTGGGGGG + Intronic
1176330127 21:5540810-5540832 AGTTAAGGCTAGATTTTTGGGGG - Intergenic
1176397630 21:6280141-6280163 AGTTAAGGCTAGATTTTTGGGGG + Intergenic
1176439527 21:6708963-6708985 AGTTAAGGCTAGATTTTTGGGGG - Intergenic
1176463789 21:7036032-7036054 AGTTAAGGCTAGATTTTTGGGGG - Intergenic
1176487350 21:7417811-7417833 AGTTAAGGCTAGATTTTTGGGGG - Intergenic
1177508771 21:22054435-22054457 GGTTATGGATAGAAATTGGAAGG - Intergenic
1178162757 21:29938855-29938877 ACTTAGGCATAAAAACTTGGAGG + Intronic
1180609693 22:17087166-17087188 AGTGAGGGACAGAAATTTGAAGG - Intronic
952678645 3:36064961-36064983 AGTTAGGGTTACACATTTGAAGG - Intergenic
952850152 3:37721415-37721437 AGTTAGGTAGTGAAATTTGGAGG - Intronic
955311376 3:57890724-57890746 AATTAGGCAAATAAATTTGGTGG + Intronic
956036315 3:65095909-65095931 AGTTGGGGACAGATATATGGTGG - Intergenic
956714629 3:72067774-72067796 AGTCGGGGATGGAAATTAGGAGG - Intergenic
960789229 3:121409197-121409219 AGCTGAGGATAGAAACTTGGGGG + Intronic
962164165 3:133031680-133031702 AGTGAGGGGTAGAAATTGTGTGG + Intergenic
962663386 3:137627973-137627995 AGCTAGAGATAATAATTTGGAGG + Intergenic
964503741 3:157376188-157376210 AGTTGGGGATGGAAACTTTGAGG - Intronic
964643968 3:158938032-158938054 AGTTTGGGAAATATATTTGGGGG + Intergenic
965170293 3:165254215-165254237 TGTTAGCAATAAAAATTTGGGGG - Intergenic
967517434 3:190387063-190387085 AGTGAGAGAAAGAAATTGGGAGG - Intronic
969940085 4:10723213-10723235 ACTTGGGCATAGAAAGTTGGGGG + Intergenic
970954567 4:21795039-21795061 AGTTAGGGCTTTGAATTTGGGGG - Intronic
971161815 4:24141114-24141136 AGTTAGGGAGAGAAGTAGGGAGG + Intergenic
972188925 4:36567515-36567537 AGTTTGGAATACATATTTGGGGG - Intergenic
974210744 4:58771367-58771389 TGTTGGAGTTAGAAATTTGGGGG + Intergenic
976704215 4:88005073-88005095 AGTGAAGTATAGAAATGTGGGGG + Intergenic
976977728 4:91185109-91185131 ATTCAGGGAAAGAAATTTAGAGG - Intronic
978191162 4:105914102-105914124 AGTTAGGGATAAAGATTTGAGGG + Intronic
978240854 4:106514634-106514656 AGTGAGGGGTAGAATTTTGAGGG - Intergenic
979186306 4:117798901-117798923 AGATAGAGATGGAAATGTGGGGG + Intergenic
980277278 4:130670265-130670287 ACTTAGGGAAAGAAGTTTGATGG - Intergenic
981864261 4:149396227-149396249 GATTATGGATAGACATTTGGGGG - Intergenic
982926568 4:161344432-161344454 AATGAGGGATAGAAAGTTGAAGG - Intergenic
983495073 4:168434526-168434548 ATTTAGGGATCCAAATTTGCTGG - Intronic
986741849 5:10711639-10711661 AGATGGGGATAGACAGTTGGAGG - Intronic
987897747 5:23969982-23970004 ACTAGGGGCTAGAAATTTGGGGG + Intronic
988494938 5:31736894-31736916 AGTAAGGGAAAGAGAATTGGGGG - Intronic
990675412 5:58178745-58178767 AATTAGGGAGAGAAAATTAGAGG - Intergenic
991492802 5:67199676-67199698 AATTAGAGAAAGAAGTTTGGCGG + Intergenic
993175056 5:84472962-84472984 AGTTAAGGCTAGAAGTTTGAAGG - Intergenic
994089166 5:95793630-95793652 TTTTAGGAATAGAAATTTGCCGG + Exonic
994128428 5:96196503-96196525 AGTTAGTGATAGATTATTGGGGG + Intergenic
995624686 5:114063503-114063525 TGTTAGAAATGGAAATTTGGAGG - Intergenic
996296035 5:121917980-121918002 AGTCAGGGGTAGAAATTATGGGG + Intergenic
996585529 5:125083710-125083732 AGATAGGGATAGAAATTAACAGG + Intergenic
997868032 5:137482077-137482099 TGTCGGGGATAGAAATTGGGAGG + Intronic
1003256171 6:4476820-4476842 AGCTACAGATAGACATTTGGGGG - Intergenic
1003267776 6:4581536-4581558 AGTCAGGGATAAAAAATTGTTGG - Intergenic
1005213388 6:23496076-23496098 ATGAAGGGATAGAGATTTGGGGG - Intergenic
1005727730 6:28666006-28666028 AGTGAAGGGAAGAAATTTGGAGG - Intergenic
1006598076 6:35208099-35208121 GGTTAGGGATATAGATTTGGTGG + Intergenic
1007159703 6:39779021-39779043 AGTTTGGGCTTGGAATTTGGAGG - Intergenic
1008280497 6:49590236-49590258 AGTAAAGCATAGAAATTTGGAGG + Intergenic
1010886575 6:81250556-81250578 AGTGAGGGATGGAAATTGGGAGG - Intergenic
1011248494 6:85344986-85345008 AGTTAGAGTTAGTACTTTGGTGG - Intergenic
1012075713 6:94682332-94682354 AGTTAGAGATAAAAATTATGGGG + Intergenic
1012270211 6:97199997-97200019 AGTCAGGGAGAGAAATTGAGAGG - Intronic
1013422019 6:109975936-109975958 AGTTATGGATGGAAATTAGATGG - Intergenic
1013975183 6:116069270-116069292 AGTTTGGGATACAAAATTTGTGG + Intergenic
1014686259 6:124505451-124505473 AGTTACGAATGGAAATTTGATGG - Intronic
1014915985 6:127148994-127149016 AGTTAGTGATAAAAATTTTCTGG - Intronic
1015673259 6:135715951-135715973 AGTAAGCCATTGAAATTTGGGGG + Intergenic
1016121691 6:140350665-140350687 AGTGAGCCATAGAAAATTGGGGG - Intergenic
1017603572 6:156109505-156109527 AGTTTAAGTTAGAAATTTGGTGG - Intergenic
1018573045 6:165230745-165230767 AGTTGGGGATAGAAATGTAAGGG - Intergenic
1020769896 7:12377307-12377329 CGTTAGGGAGAGAAACTTGAAGG + Intronic
1022295486 7:29047599-29047621 AGTTTGGAAAAGAGATTTGGGGG + Intronic
1023622860 7:42090640-42090662 ACTTAGGGACAGAGATATGGAGG - Intronic
1026483690 7:70799860-70799882 TTTTAGGGAGATAAATTTGGTGG + Intergenic
1027485539 7:78757118-78757140 AGTTAGGTGGAGAGATTTGGTGG - Intronic
1028731586 7:94157401-94157423 GGCTAGAGATAGAAATTTGGAGG + Intergenic
1030254530 7:107493592-107493614 ATTTAGGGATTGAGATTTGTGGG - Intronic
1030378588 7:108783849-108783871 ATTAAGGGAGAGAAATTTGCAGG - Intergenic
1030916460 7:115320314-115320336 AGTTAGGGGTAGAAAATTCATGG + Intergenic
1031199789 7:118666839-118666861 AGTTAGGGAAATAGCTTTGGAGG - Intergenic
1031461886 7:122061355-122061377 TGTTAATGATATAAATTTGGCGG - Exonic
1032577382 7:133069673-133069695 AGTTATTGATGGAAATGTGGTGG - Intronic
1033990826 7:147284299-147284321 TTTTAGTGATAAAAATTTGGAGG + Intronic
1035590994 8:813313-813335 ATTTATGGATATAAATTAGGTGG + Intergenic
1035903376 8:3481593-3481615 AGTTAAGGATCGAAATGTGGGGG + Intronic
1036911372 8:12760048-12760070 TGTTAGTGATAAAAATCTGGTGG + Intergenic
1037480222 8:19298198-19298220 AGTTAAGCATAGAAATTAAGAGG + Intergenic
1038989972 8:32857435-32857457 AGTGATAGATGGAAATTTGGTGG + Intergenic
1039159656 8:34603141-34603163 AATTGGGCATATAAATTTGGAGG + Intergenic
1041021699 8:53644510-53644532 AGTTGGGGACAGAAATGGGGAGG + Intergenic
1041062581 8:54050035-54050057 GCTCAGGGATAGAACTTTGGGGG - Intronic
1041760552 8:61361686-61361708 AAGTAGGGATAGAAACATGGTGG - Intronic
1043309707 8:78843105-78843127 AGCTACAGATAGAAATTTGAAGG + Intergenic
1043744198 8:83853077-83853099 AGAGAGGGTTAGGAATTTGGTGG - Intergenic
1044050577 8:87497848-87497870 AGCTGGGGAGAGAAATTTGAAGG + Intronic
1045336525 8:101208722-101208744 ATTTGGAGATAGAAATGTGGGGG - Intergenic
1046341288 8:112859482-112859504 AGTTATGAATAGAAATTTGAGGG + Intronic
1047092578 8:121590144-121590166 AGCTGGGGACATAAATTTGGGGG - Intergenic
1047140984 8:122139368-122139390 TTTTAGGGGGAGAAATTTGGGGG - Intergenic
1048495625 8:134933456-134933478 AGTTGGGGCTGGAACTTTGGGGG + Intergenic
1048621316 8:136135598-136135620 AGTTAGAGATAGAAATTAGGAGG - Intergenic
1049261608 8:141641988-141642010 AATTAGGGAGAGAAATGGGGTGG + Intergenic
1051572527 9:18576344-18576366 AGTTTGGGAGAGAAACATGGAGG + Intronic
1056282032 9:85051144-85051166 AGAGACAGATAGAAATTTGGGGG - Intergenic
1056974166 9:91235295-91235317 AGGTAGGGAGAGAGATGTGGAGG + Intronic
1057755513 9:97831873-97831895 AGAGAGAGATCGAAATTTGGGGG + Intergenic
1061695268 9:132368786-132368808 GGTTAGGGGTAGAGAGTTGGAGG - Intergenic
1203431968 Un_GL000195v1:99516-99538 AGTTAAGGCTAGATTTTTGGGGG + Intergenic
1185453656 X:296600-296622 AGTTAGAAATGCAAATTTGGGGG - Intronic
1185654660 X:1674572-1674594 AGAAAGGGAAAGAAATTTGAAGG - Intergenic
1185847952 X:3457375-3457397 AGTTAATGATATAAATTTGAGGG - Intergenic
1187093113 X:16118173-16118195 GACTAGGGATATAAATTTGGGGG - Intergenic
1188203122 X:27317298-27317320 AGACAGGGATGGAAATTTGGGGG + Intergenic
1188204894 X:27343929-27343951 AGACAGAGATGGAAATTTGGGGG + Intergenic
1189842489 X:45095416-45095438 AGTTGGGGATAGCACTTTGTGGG + Intronic
1189935047 X:46058641-46058663 ACTTAGAGGTACAAATTTGGTGG + Intergenic
1190812617 X:53899269-53899291 AGTCAGGGACAGAAATTCAGTGG - Intergenic
1192763874 X:74123448-74123470 GGTTAGGGGTCCAAATTTGGGGG + Intergenic
1193078092 X:77376394-77376416 AGTTGGGGAAACATATTTGGGGG + Intergenic
1194465975 X:94236144-94236166 AGTTAGGAAAACATATTTGGGGG - Intergenic
1194624242 X:96210334-96210356 AGTCAGGGAGAGAAATTAGAGGG - Intergenic
1195157239 X:102136260-102136282 TGGTAGGGAAATAAATTTGGGGG + Intergenic
1195890644 X:109689726-109689748 AGTAAGGGATAGAAAGTGTGGGG - Intronic
1197523925 X:127537724-127537746 AGTTAGGGCTTTTAATTTGGGGG + Intergenic
1198426657 X:136527739-136527761 AGTTAGAGATATACATTTAGGGG - Intergenic
1198439831 X:136652309-136652331 TTTTAGGGTGAGAAATTTGGGGG - Intronic
1198567981 X:137924676-137924698 AGTAAGGGAGGGAAATTTTGAGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1201616855 Y:15909916-15909938 AGTTATGTATATAAATTTGGGGG + Intergenic