ID: 911413415

View in Genome Browser
Species Human (GRCh38)
Location 1:97540267-97540289
Sequence CTAACCCGAAGAAGGGGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 184}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911413415_911413430 23 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413430 1:97540313-97540335 AGAACCCGGGGTGGGGGGTGGGG No data
911413415_911413437 30 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413437 1:97540320-97540342 GGGGTGGGGGGTGGGGGGTGGGG 0: 36
1: 95
2: 665
3: 3302
4: 12242
911413415_911413421 10 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413421 1:97540300-97540322 TAGAGCAGCTTACAGAACCCGGG 0: 1
1: 13
2: 98
3: 256
4: 609
911413415_911413436 29 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413436 1:97540319-97540341 CGGGGTGGGGGGTGGGGGGTGGG 0: 5
1: 63
2: 330
3: 8961
4: 16381
911413415_911413427 18 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413427 1:97540308-97540330 CTTACAGAACCCGGGGTGGGGGG 0: 1
1: 0
2: 1
3: 17
4: 381
911413415_911413428 21 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413428 1:97540311-97540333 ACAGAACCCGGGGTGGGGGGTGG No data
911413415_911413431 24 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413431 1:97540314-97540336 GAACCCGGGGTGGGGGGTGGGGG No data
911413415_911413422 11 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413422 1:97540301-97540323 AGAGCAGCTTACAGAACCCGGGG No data
911413415_911413423 14 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413423 1:97540304-97540326 GCAGCTTACAGAACCCGGGGTGG No data
911413415_911413420 9 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413420 1:97540299-97540321 TTAGAGCAGCTTACAGAACCCGG 0: 1
1: 0
2: 1
3: 17
4: 145
911413415_911413426 17 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413426 1:97540307-97540329 GCTTACAGAACCCGGGGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 115
911413415_911413435 28 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413435 1:97540318-97540340 CCGGGGTGGGGGGTGGGGGGTGG No data
911413415_911413429 22 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413429 1:97540312-97540334 CAGAACCCGGGGTGGGGGGTGGG No data
911413415_911413424 15 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413424 1:97540305-97540327 CAGCTTACAGAACCCGGGGTGGG 0: 1
1: 0
2: 1
3: 12
4: 73
911413415_911413425 16 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413425 1:97540306-97540328 AGCTTACAGAACCCGGGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 97
911413415_911413432 25 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413432 1:97540315-97540337 AACCCGGGGTGGGGGGTGGGGGG 0: 1
1: 2
2: 43
3: 235
4: 1533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911413415 Original CRISPR CTAACCCGAAGAAGGGGTTG TGG (reversed) Intronic