ID: 911413420

View in Genome Browser
Species Human (GRCh38)
Location 1:97540299-97540321
Sequence TTAGAGCAGCTTACAGAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911413416_911413420 3 Left 911413416 1:97540273-97540295 CCCCTTCTTCGGGTTAGATTAAC 0: 1
1: 0
2: 1
3: 16
4: 130
Right 911413420 1:97540299-97540321 TTAGAGCAGCTTACAGAACCCGG 0: 1
1: 0
2: 1
3: 17
4: 145
911413414_911413420 10 Left 911413414 1:97540266-97540288 CCCACAACCCCTTCTTCGGGTTA 0: 1
1: 0
2: 7
3: 45
4: 211
Right 911413420 1:97540299-97540321 TTAGAGCAGCTTACAGAACCCGG 0: 1
1: 0
2: 1
3: 17
4: 145
911413418_911413420 1 Left 911413418 1:97540275-97540297 CCTTCTTCGGGTTAGATTAACTG No data
Right 911413420 1:97540299-97540321 TTAGAGCAGCTTACAGAACCCGG 0: 1
1: 0
2: 1
3: 17
4: 145
911413417_911413420 2 Left 911413417 1:97540274-97540296 CCCTTCTTCGGGTTAGATTAACT 0: 1
1: 0
2: 2
3: 25
4: 201
Right 911413420 1:97540299-97540321 TTAGAGCAGCTTACAGAACCCGG 0: 1
1: 0
2: 1
3: 17
4: 145
911413415_911413420 9 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413420 1:97540299-97540321 TTAGAGCAGCTTACAGAACCCGG 0: 1
1: 0
2: 1
3: 17
4: 145
911413411_911413420 29 Left 911413411 1:97540247-97540269 CCAGCTATAAACTGGGATTCCCA 0: 1
1: 5
2: 25
3: 57
4: 208
Right 911413420 1:97540299-97540321 TTAGAGCAGCTTACAGAACCCGG 0: 1
1: 0
2: 1
3: 17
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911413420 Original CRISPR TTAGAGCAGCTTACAGAACC CGG Intronic