ID: 911413430

View in Genome Browser
Species Human (GRCh38)
Location 1:97540313-97540335
Sequence AGAACCCGGGGTGGGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911413414_911413430 24 Left 911413414 1:97540266-97540288 CCCACAACCCCTTCTTCGGGTTA 0: 1
1: 0
2: 7
3: 45
4: 211
Right 911413430 1:97540313-97540335 AGAACCCGGGGTGGGGGGTGGGG No data
911413418_911413430 15 Left 911413418 1:97540275-97540297 CCTTCTTCGGGTTAGATTAACTG No data
Right 911413430 1:97540313-97540335 AGAACCCGGGGTGGGGGGTGGGG No data
911413416_911413430 17 Left 911413416 1:97540273-97540295 CCCCTTCTTCGGGTTAGATTAAC 0: 1
1: 0
2: 1
3: 16
4: 130
Right 911413430 1:97540313-97540335 AGAACCCGGGGTGGGGGGTGGGG No data
911413415_911413430 23 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413430 1:97540313-97540335 AGAACCCGGGGTGGGGGGTGGGG No data
911413417_911413430 16 Left 911413417 1:97540274-97540296 CCCTTCTTCGGGTTAGATTAACT 0: 1
1: 0
2: 2
3: 25
4: 201
Right 911413430 1:97540313-97540335 AGAACCCGGGGTGGGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911413430 Original CRISPR AGAACCCGGGGTGGGGGGTG GGG Intronic