ID: 911413437

View in Genome Browser
Species Human (GRCh38)
Location 1:97540320-97540342
Sequence GGGGTGGGGGGTGGGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16340
Summary {0: 36, 1: 95, 2: 665, 3: 3302, 4: 12242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911413416_911413437 24 Left 911413416 1:97540273-97540295 CCCCTTCTTCGGGTTAGATTAAC 0: 1
1: 0
2: 1
3: 16
4: 130
Right 911413437 1:97540320-97540342 GGGGTGGGGGGTGGGGGGTGGGG 0: 36
1: 95
2: 665
3: 3302
4: 12242
911413415_911413437 30 Left 911413415 1:97540267-97540289 CCACAACCCCTTCTTCGGGTTAG 0: 1
1: 0
2: 2
3: 23
4: 184
Right 911413437 1:97540320-97540342 GGGGTGGGGGGTGGGGGGTGGGG 0: 36
1: 95
2: 665
3: 3302
4: 12242
911413418_911413437 22 Left 911413418 1:97540275-97540297 CCTTCTTCGGGTTAGATTAACTG No data
Right 911413437 1:97540320-97540342 GGGGTGGGGGGTGGGGGGTGGGG 0: 36
1: 95
2: 665
3: 3302
4: 12242
911413417_911413437 23 Left 911413417 1:97540274-97540296 CCCTTCTTCGGGTTAGATTAACT 0: 1
1: 0
2: 2
3: 25
4: 201
Right 911413437 1:97540320-97540342 GGGGTGGGGGGTGGGGGGTGGGG 0: 36
1: 95
2: 665
3: 3302
4: 12242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911413437 Original CRISPR GGGGTGGGGGGTGGGGGGTG GGG Intronic