ID: 911413438

View in Genome Browser
Species Human (GRCh38)
Location 1:97540321-97540343
Sequence GGGTGGGGGGTGGGGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22781
Summary {0: 31, 1: 89, 2: 617, 3: 3358, 4: 18686}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911413418_911413438 23 Left 911413418 1:97540275-97540297 CCTTCTTCGGGTTAGATTAACTG No data
Right 911413438 1:97540321-97540343 GGGTGGGGGGTGGGGGGTGGGGG 0: 31
1: 89
2: 617
3: 3358
4: 18686
911413416_911413438 25 Left 911413416 1:97540273-97540295 CCCCTTCTTCGGGTTAGATTAAC 0: 1
1: 0
2: 1
3: 16
4: 130
Right 911413438 1:97540321-97540343 GGGTGGGGGGTGGGGGGTGGGGG 0: 31
1: 89
2: 617
3: 3358
4: 18686
911413417_911413438 24 Left 911413417 1:97540274-97540296 CCCTTCTTCGGGTTAGATTAACT 0: 1
1: 0
2: 2
3: 25
4: 201
Right 911413438 1:97540321-97540343 GGGTGGGGGGTGGGGGGTGGGGG 0: 31
1: 89
2: 617
3: 3358
4: 18686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911413438 Original CRISPR GGGTGGGGGGTGGGGGGTGG GGG Intronic