ID: 911413440

View in Genome Browser
Species Human (GRCh38)
Location 1:97540327-97540349
Sequence GGGGTGGGGGGTGGGGGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18296
Summary {0: 5, 1: 66, 2: 723, 3: 3839, 4: 13663}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911413417_911413440 30 Left 911413417 1:97540274-97540296 CCCTTCTTCGGGTTAGATTAACT 0: 1
1: 0
2: 2
3: 25
4: 201
Right 911413440 1:97540327-97540349 GGGGTGGGGGGTGGGGGTGGCGG 0: 5
1: 66
2: 723
3: 3839
4: 13663
911413418_911413440 29 Left 911413418 1:97540275-97540297 CCTTCTTCGGGTTAGATTAACTG No data
Right 911413440 1:97540327-97540349 GGGGTGGGGGGTGGGGGTGGCGG 0: 5
1: 66
2: 723
3: 3839
4: 13663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911413440 Original CRISPR GGGGTGGGGGGTGGGGGTGG CGG Intronic