ID: 911421522

View in Genome Browser
Species Human (GRCh38)
Location 1:97647170-97647192
Sequence CTGTTGACTTTAAGGAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911421519_911421522 4 Left 911421519 1:97647143-97647165 CCTAAAAAAATGCATTTTTTGAT No data
Right 911421522 1:97647170-97647192 CTGTTGACTTTAAGGAGAAATGG No data
911421518_911421522 28 Left 911421518 1:97647119-97647141 CCACTTGTATTTGTTTTCTGATT No data
Right 911421522 1:97647170-97647192 CTGTTGACTTTAAGGAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911421522 Original CRISPR CTGTTGACTTTAAGGAGAAA TGG Intronic
No off target data available for this crispr