ID: 911423671

View in Genome Browser
Species Human (GRCh38)
Location 1:97679094-97679116
Sequence AAAGCTGCTTTCATTGGAAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911423671_911423674 26 Left 911423671 1:97679094-97679116 CCTATTCCAATGAAAGCAGCTTT 0: 1
1: 0
2: 2
3: 28
4: 247
Right 911423674 1:97679143-97679165 GAGTCATTTCATTCACTGAAAGG 0: 1
1: 0
2: 0
3: 13
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911423671 Original CRISPR AAAGCTGCTTTCATTGGAAT AGG (reversed) Exonic
900852547 1:5155408-5155430 AAAGCTACTTTTGTTTGAATGGG - Intergenic
902121967 1:14173903-14173925 AGAGCTGCTTTTATTAGAAGAGG + Intergenic
904342675 1:29847156-29847178 AGAGATGCTTTCCTTGGAGTTGG + Intergenic
906129117 1:43445496-43445518 AAAGCTGCTGTCTTTTGATTGGG - Intronic
906231877 1:44171430-44171452 AAAGTTGCTTTCTTTGGTCTTGG - Intergenic
907000467 1:50847985-50848007 AAAGATGCTTTCACTGGATATGG - Intronic
907096890 1:51790297-51790319 AGAGCTGCTCTGATTGAAATTGG + Intronic
908110054 1:60887979-60888001 ATAGCTCCTTTCATGGGAAGTGG - Intronic
908579997 1:65504947-65504969 AATTCTGATTTAATTGGAATGGG - Intronic
908905734 1:69006765-69006787 AAAGCTTCCTTTATTGGTATAGG + Intergenic
908930784 1:69314376-69314398 AAATTTTCTTTCATTGGAATTGG + Intergenic
909819740 1:80046957-80046979 AAAGCTTCTTTAATAGGAATAGG - Intergenic
910115794 1:83730379-83730401 AAATCTGTTTTTATTAGAATAGG + Intergenic
910769480 1:90816618-90816640 AAAGATGCTTTCTTTCAAATAGG + Intergenic
911423671 1:97679094-97679116 AAAGCTGCTTTCATTGGAATAGG - Exonic
911505316 1:98742088-98742110 AAAGGTGATTTCACTGGACTGGG - Intronic
912330146 1:108812780-108812802 AAATCTGCTTGCATTCCAATAGG - Intergenic
918634810 1:186763268-186763290 AAGGCTGTTTTCATTGGAGAGGG + Intergenic
919014062 1:192006375-192006397 AAAACTGTTTTCATTAAAATGGG - Intergenic
919812783 1:201419676-201419698 AAAGCTGTGTTCATTGGGGTTGG - Intronic
921271322 1:213473002-213473024 AAAGCACAGTTCATTGGAATAGG - Intergenic
923604444 1:235430461-235430483 AAAGATGCTTTCACAGGATTAGG - Intronic
923618802 1:235560327-235560349 AATGCTGTTATCATGGGAATGGG + Intronic
923911422 1:238448999-238449021 AAAAATGTTTTCAATGGAATAGG - Intergenic
924886122 1:248218767-248218789 CAAGCTGCTTTCACTGGAAAAGG + Intergenic
1063800796 10:9575186-9575208 AAAGATGGTTTCATTGCCATTGG + Intergenic
1065757430 10:28945504-28945526 AAATCTGCTTTCATTTAAATTGG + Intergenic
1066243055 10:33556483-33556505 AAAGCAGCATTCACTGGAAAAGG - Intergenic
1067397827 10:45939490-45939512 AAGGCTGCTTTCATTTGATTAGG + Intergenic
1067866147 10:49908584-49908606 AAGGCTGCTTTCATTTGATTAGG + Intronic
1068288448 10:54970337-54970359 AAAGCTGCTTTCATTTTTCTAGG - Intronic
1071162002 10:82758069-82758091 AAAGCTGCTTTGTTTTGACTAGG - Intronic
1071357946 10:84817527-84817549 AAAGTTGCTGTCCTTTGAATGGG + Intergenic
1071447360 10:85761288-85761310 AAAGCTGCTATCTTTGGTTTGGG - Intronic
1071858585 10:89650004-89650026 AAAGGTGGTTTCAATTGAATAGG + Intergenic
1072354332 10:94591747-94591769 AGAGCTACTTTCATTTGAGTGGG - Intronic
1072416742 10:95253159-95253181 AAATCTGCTGTCTTTTGAATTGG - Intronic
1074236619 10:111591076-111591098 GAAGCTGCTTTCACTGTAAGTGG + Intergenic
1078092572 11:8276246-8276268 AAAGAGGCTTTCTTTTGAATGGG - Intergenic
1078307733 11:10207126-10207148 AAATTTGCTGTCATTTGAATTGG - Intronic
1079740527 11:24053675-24053697 AAAACAGATTTCATTTGAATGGG - Intergenic
1079891191 11:26055242-26055264 AAAGTTGGTTTCATTGGGAGTGG - Intergenic
1081394123 11:42564734-42564756 CAAGCTGCTTTCATAGGAGAGGG + Intergenic
1082152364 11:48756942-48756964 AAAGATTCTTTCTGTGGAATTGG - Intergenic
1082645536 11:55720084-55720106 AAAGCTGCTCTCAGTGGAGAGGG + Intergenic
1083729975 11:64647665-64647687 ACAGCTGGTTTCCCTGGAATGGG - Intronic
1085332181 11:75662764-75662786 AAATCTGATTTCATTGGTCTGGG - Intronic
1085365396 11:75937500-75937522 GAAGATGCTTTCATTGGGCTTGG + Intronic
1086877855 11:92119365-92119387 AAATCTGCTATCATTCTAATTGG + Intergenic
1088044837 11:105436799-105436821 AAATCTGCCGTCATTTGAATTGG + Intergenic
1089264008 11:117244528-117244550 GAAGCTGCTTTAATTGCACTTGG - Exonic
1091578150 12:1759014-1759036 AAAGCTGCCTTTATGAGAATTGG + Intronic
1093104962 12:15075172-15075194 AAAGCCACTTTCCTTGGAAAAGG + Intergenic
1093204498 12:16231191-16231213 AAATCTTCTTTTAGTGGAATAGG - Intronic
1093785644 12:23189067-23189089 AATGCTACTATCAGTGGAATGGG + Intergenic
1094098758 12:26738077-26738099 AAAGCTTCTATCATTGTACTTGG - Intronic
1094404707 12:30104977-30104999 AAAACTGCTTTCATAGAAGTAGG + Intergenic
1094789262 12:33891886-33891908 AAAGTTGTTTTCAATGGATTTGG - Intergenic
1095215588 12:39543706-39543728 AAAATTGCTTTCTTTGCAATTGG - Intergenic
1095681260 12:44979114-44979136 AAAGATGTTTTCACTGTAATAGG - Intergenic
1096006682 12:48179001-48179023 AAAACAGGTTTAATTGGAATGGG + Intronic
1097478689 12:60092461-60092483 AATTCTGCTTTCATTCAAATTGG + Intergenic
1098002009 12:65954821-65954843 TAAGCTGTTTTCATTGGTTTTGG - Intronic
1098701495 12:73633623-73633645 AAATCTGCTGTCTTTAGAATTGG - Intergenic
1099224151 12:79949180-79949202 AAAGCTGAGTTCTTGGGAATTGG + Intergenic
1099727150 12:86446321-86446343 AAAGCTGCTCCAATTGGCATTGG + Intronic
1099751368 12:86778098-86778120 AAAGCTGCTTTGAAAGGAAAAGG - Intronic
1099977059 12:89557094-89557116 ATGGCTGCTTTCATGGGAGTTGG - Intergenic
1101205377 12:102481920-102481942 AAACCTGCTTTGTTTGGAAGGGG + Intergenic
1103691407 12:122777613-122777635 ACAGCTTCTTTCATGGGAAGAGG + Exonic
1108000534 13:45901897-45901919 ATTGCTACTTTCATTGGAAAGGG - Intergenic
1108105656 13:47005891-47005913 TAAGTTGCTTTCATTGGAGGAGG + Intergenic
1108598615 13:51971909-51971931 AGAGCTGCTTTCAGTGGCGTGGG - Intronic
1110313732 13:74080953-74080975 AGAGCTGCTGTCAGTGGACTAGG - Intronic
1110406362 13:75154818-75154840 AAAGCTGCTTTTGTTCCAATAGG - Intergenic
1115144386 14:30209674-30209696 AAAGCTGTTATCATGGGAGTGGG - Intergenic
1116383560 14:44301958-44301980 AAAACAGCTTTCAGTGGAAAGGG - Intergenic
1116737233 14:48707433-48707455 AAAGCTTCTATCATTGAAATGGG + Intergenic
1117356443 14:54928279-54928301 AGACCTGATTTCATTGGCATGGG + Intergenic
1118120543 14:62836229-62836251 AAACCTGCTTTCATTTGTACAGG - Intronic
1120588406 14:86345627-86345649 AGTGCTGCAGTCATTGGAATGGG + Intergenic
1121162435 14:91756674-91756696 AAAGTTGCCTTCATTTAAATTGG - Intronic
1123205982 14:106713819-106713841 GAACATCCTTTCATTGGAATTGG - Intergenic
1124090241 15:26592697-26592719 AAAGCTTCTTACATTTTAATGGG + Intronic
1126984818 15:54293506-54293528 AAAGCTAATTTTATTGCAATGGG - Intronic
1127070245 15:55281834-55281856 TTAGTTGCTTTCATTGTAATAGG - Intronic
1127070519 15:55284153-55284175 AAGGCTGCTTTCTTTTAAATAGG + Intronic
1129809546 15:78497168-78497190 AAAGATCATTTGATTGGAATTGG + Exonic
1130142383 15:81238975-81238997 AAATCTGCTGTCATTTGAATTGG + Intronic
1138710921 16:58969772-58969794 AAAACAGCTTTCATTGGAGAGGG + Intergenic
1138914195 16:61442799-61442821 ATAGCTGTTTCCATTGGAGTAGG + Intergenic
1140759399 16:78097599-78097621 AAATCTGCTACCATTGGATTGGG - Intergenic
1141309983 16:82904321-82904343 AAAGCTACTTGCAATGGATTTGG - Intronic
1144128708 17:12225396-12225418 ATGGCTGATTTCATAGGAATGGG + Intergenic
1148056822 17:44803575-44803597 AAAGCTACTTGTATTGGAAATGG - Exonic
1148498942 17:48074261-48074283 AATGCTGCCTTCATTGGCAATGG + Intronic
1148975463 17:51524146-51524168 AATGCTGTTATCATGGGAATGGG - Intergenic
1150973551 17:70058262-70058284 AAACCTGATTTCATGGTAATGGG - Intronic
1151098455 17:71527199-71527221 GAAGCTGCGTACATTAGAATAGG - Intergenic
1151471565 17:74321629-74321651 GAAGCTGCTTTCATTGGATAAGG + Intergenic
1153520454 18:5948133-5948155 AAAGATGATTTTATAGGAATAGG + Intergenic
1153612547 18:6900925-6900947 AAATCTGCTATTATTTGAATTGG - Intronic
1157040509 18:44033530-44033552 AAAGCAGCTTTCAGCGGAGTGGG - Intergenic
1159628613 18:70723392-70723414 AAGGCTGCTTTCATTGGGATTGG + Intergenic
1163240336 19:16058903-16058925 AAAGCTGCCTTCTTTGGCTTAGG - Intergenic
1163404844 19:17115808-17115830 AAAGCTGCTTTCATTACATTTGG - Intronic
1164979124 19:32599888-32599910 TAAGCTGCTTCAATTGTAATTGG - Intronic
1165663130 19:37600036-37600058 AAACCTGATTTCATTGACATTGG - Intronic
926476077 2:13324230-13324252 AAAGCTGCTTTCTTTGTTTTTGG + Intergenic
926667933 2:15545196-15545218 AAAGATGCTTATATTAGAATAGG + Intronic
926993901 2:18713125-18713147 AAATATGTTTTCATTAGAATCGG + Intergenic
928504074 2:31930619-31930641 TAAGCTTCTTTCATTTGACTTGG - Intronic
930315829 2:49795976-49795998 AAAGCTGATTCCATTATAATGGG - Intergenic
932119955 2:69089277-69089299 TAAGATGCATTCATTGAAATAGG - Intronic
933884941 2:86710371-86710393 AAATCTGCTGTCACTTGAATTGG + Intronic
933925232 2:87086317-87086339 AAATCTGCTGTCACTTGAATTGG - Intergenic
934906439 2:98209074-98209096 GAAACTGCTGTCATTTGAATTGG + Intronic
935958178 2:108399260-108399282 AAAGTGGCTTTCAGTGGGATGGG - Intergenic
936272659 2:111061300-111061322 AAATATGCTGTCATTTGAATTGG - Intronic
937234204 2:120420619-120420641 AAAGCTTGTTTCCTTGGACTAGG - Intergenic
938085785 2:128400803-128400825 AAATCTGCTTTCATTAGAGTTGG + Intergenic
942553598 2:177147922-177147944 AGAGCTGCTTTAATTAAAATCGG - Intergenic
942959561 2:181813746-181813768 AAAGATGTTGTCATTGGAAATGG + Intergenic
943525358 2:189009267-189009289 AAAGCTGCTTAGATTAGAATGGG + Intronic
944898554 2:204191085-204191107 AAAGCAGCTCTCATAGGATTTGG - Intergenic
945046662 2:205787926-205787948 AAAGCTTATTTCATTAGAAGAGG + Intronic
945224870 2:207523392-207523414 CAAGCTGCTATCAGTGGAGTTGG + Intergenic
945923726 2:215782539-215782561 GAATATGCTTTCATTGTAATGGG + Intergenic
947829968 2:233132685-233132707 CAAACTGCTTTGATTAGAATAGG + Intronic
947985346 2:234443027-234443049 AACGCTGCTATTATTGAAATGGG - Intergenic
949068948 2:242011838-242011860 AAGGCTGCTTTCATTTGCTTTGG - Intergenic
1169677821 20:8174274-8174296 GAAACTGCTATCATTTGAATTGG - Intronic
1171110013 20:22472310-22472332 AACGCTCATTTCATTGTAATCGG - Intergenic
1172613289 20:36267123-36267145 AAAGCTGCCTACAATGGAATGGG + Intronic
1172748155 20:37229384-37229406 CAAGGTGCTTTCAGTGCAATGGG + Intronic
1173331314 20:42078293-42078315 AAAGTTGCTTCCATTGGCATGGG - Exonic
1177508403 21:22049540-22049562 AAAGATGTTTTCATTTAAATGGG - Intergenic
1178887310 21:36494296-36494318 CAAGCTTCTTTGATTGAAATGGG - Intronic
1180606592 22:17063599-17063621 AAATCTGCTTTCATTTGTCTTGG - Intergenic
1182837405 22:33355047-33355069 AAATATGTTTGCATTGGAATAGG + Intronic
1182921719 22:34086371-34086393 AAAGCTGCTTTCATGGTATCTGG - Intergenic
949319541 3:2793870-2793892 AAAGATTCTTTCATAGGAATGGG - Intronic
949777300 3:7647311-7647333 AAAGCTGCTTTCTCAGGATTGGG - Intronic
950640430 3:14345017-14345039 ATAGGTGCTTTTCTTGGAATAGG - Intergenic
951250962 3:20394135-20394157 AAAGCAGCTTTCAGTGGAGAGGG - Intergenic
953011418 3:39028825-39028847 AATGCTGCTCTCATGGGACTGGG - Intergenic
953261114 3:41339766-41339788 AAAGCTGCTGTCTTTAGAAAGGG - Intronic
955602810 3:60666442-60666464 AAATCTGCTGTCATTTGAATTGG + Intronic
957314483 3:78559751-78559773 AAAGTTGTTATCATTGGAGTGGG + Intergenic
958923733 3:100135111-100135133 AGAGCTGTTATCATTAGAATTGG + Intronic
959211036 3:103381414-103381436 AAAACTCCTGTCATTGGCATTGG + Intergenic
959330465 3:104997783-104997805 AAAATTGCTATCATTTGAATGGG - Intergenic
960640615 3:119819275-119819297 AAAGCTGCATTCATTGAGTTTGG - Intergenic
961233544 3:125342414-125342436 AAATCTGGTGTCATTTGAATTGG - Intronic
964652619 3:159028410-159028432 AAATCTTCTTTCAATTGAATGGG + Intronic
965036480 3:163445511-163445533 GAAGTTGCTTTCCTTGGAATGGG - Intergenic
965272818 3:166639464-166639486 GAAGCTGCTTGCATTGCACTTGG + Intergenic
965630882 3:170731328-170731350 AAAGCAGCTATCATTGGCAAGGG - Intronic
965928120 3:174008310-174008332 AAACCTGCTGTCATTGAGATGGG + Intronic
967200528 3:187068850-187068872 ACAGCTGTTTTCAGGGGAATAGG + Intronic
967330896 3:188288278-188288300 AAAGTTGCTCTCCTTGGCATTGG + Intronic
967546416 3:190734283-190734305 AAAGTTGCTTACAATGTAATGGG - Intergenic
968017916 3:195356260-195356282 AATGCTCCATTCATTGGCATTGG - Intronic
968951979 4:3700064-3700086 GAAGCTGCTGTGCTTGGAATGGG + Intergenic
970783256 4:19765808-19765830 AAAGCTGCTATTAGTGTAATGGG + Intergenic
972936900 4:44147314-44147336 TAAGCTGCTTTCCTTGGCCTGGG + Intergenic
973861228 4:55067048-55067070 AAAGGTTCTTTCCTTTGAATTGG - Intergenic
974607851 4:64175187-64175209 AAAGATGCTTTCAGTGAAGTTGG + Intergenic
975355179 4:73393996-73394018 AAAGCTACATTCATTGCTATTGG - Intergenic
975408966 4:74025600-74025622 AAAGCTATTTTCATTGGCCTTGG - Intergenic
975519590 4:75286216-75286238 GATTCTGATTTCATTGGAATGGG - Intergenic
976292130 4:83430550-83430572 CATGCTGATTTCATTGAAATTGG - Intronic
976603563 4:86961544-86961566 AAAGCTGATTTCTTTGCACTGGG + Intronic
977395371 4:96464380-96464402 AAATGTGCTTTCTTTGTAATGGG + Intergenic
979772602 4:124547137-124547159 AATGCAGATTTCATTGGTATAGG - Intergenic
980436941 4:132788748-132788770 CAGGCTGCTTGCATTGGACTAGG - Intergenic
981927169 4:150152840-150152862 AATGGTGCTTTAAGTGGAATAGG + Intronic
982629515 4:157814240-157814262 AAAGCCGTTTTAACTGGAATGGG - Intergenic
983292126 4:165819976-165819998 GAAGCTGCATTCATTTGAAGGGG - Intergenic
984090695 4:175371191-175371213 AAAGCTTCCTTCATTGCAGTGGG - Intergenic
985371245 4:189287210-189287232 AAAGCTGCTTTGATTTGATTGGG - Intergenic
987509015 5:18811563-18811585 AAAGATGCTTTAAGTGCAATTGG - Intergenic
987967305 5:24893253-24893275 ACAGCTGCTTTCATGGGATGAGG + Intergenic
989223210 5:38993438-38993460 AGAGCTGCCTGCATTGGAAGGGG + Intronic
990677634 5:58205602-58205624 GAAGCAGCTGTCATTGGAACCGG - Intergenic
991957929 5:72014444-72014466 GAAGCTGCTTTCCTAGGAAGGGG - Intergenic
992286286 5:75238591-75238613 AACTCTGCTTTCACAGGAATTGG + Intergenic
992745510 5:79816369-79816391 AAATCTGCTGTCAGTGGAGTGGG + Intergenic
992761923 5:79957995-79958017 AGAGCTGCTTTAGTTGGAGTAGG - Intergenic
993021542 5:82597580-82597602 AATGCTGCCTGCTTTGGAATGGG + Intergenic
996557888 5:124797673-124797695 AAAGCAGCTCTCAGTGGAAAGGG - Intergenic
996627225 5:125585215-125585237 AAAGCTGCTCTGATTGTATTTGG - Intergenic
997603001 5:135153199-135153221 AAAGCTGCTTTGGTTAAAATGGG + Intronic
997937745 5:138129179-138129201 AAATCTGATTTCATTGTAATGGG - Intronic
999355155 5:150921299-150921321 GAATCTGCTGTCATTAGAATTGG - Intergenic
999398976 5:151249897-151249919 AAAGTTGCTTTAAGTGGCATGGG - Intronic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1000398148 5:160797327-160797349 AAAGCTGCTTTCAGAGCAAAAGG - Intronic
1000804899 5:165777615-165777637 AAAACTGCTCTAATTGGATTCGG + Intergenic
1004051058 6:12079693-12079715 AAGGCTGATTTAATTGGAGTGGG + Intronic
1005580198 6:27226830-27226852 AAAGCCCCTTTCAGTGGAACAGG + Intergenic
1009298125 6:61980515-61980537 AAAGCTGGCTACATTTGAATGGG + Intronic
1010947553 6:81995823-81995845 AATGCTGCTTTCATTTCATTAGG + Intergenic
1011528955 6:88298949-88298971 GAATCTGCTTTTAGTGGAATGGG - Intergenic
1014865570 6:126525471-126525493 AAAGGTGCTTTCAATGGGAAAGG + Intergenic
1016300301 6:142623026-142623048 AAAGCTCCTCTCTTTGGAAAAGG + Intergenic
1018063542 6:160109238-160109260 AAGGCTGCTTTCTCTGGGATGGG - Intronic
1018166468 6:161102365-161102387 ATTGCTGCTTCCATTGGAGTAGG + Intronic
1018881444 6:167886179-167886201 AAAGCTCATTTCATTGGGATGGG + Intronic
1021346736 7:19538409-19538431 AAAGCTATTTCCATTTGAATTGG + Intergenic
1022794232 7:33719331-33719353 AAAGCTCTTTTCACGGGAATGGG + Intergenic
1023323593 7:39027535-39027557 AGAGCTGCTCTGATTGGAATTGG - Intronic
1025057022 7:55773178-55773200 TAGGATGCTTTCATTGGATTTGG + Intergenic
1025084499 7:56011850-56011872 TAGGATGCTTTCATTGGATTTGG - Exonic
1027168545 7:75853463-75853485 AAAGCTCCTTACCTGGGAATGGG + Intronic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1028658850 7:93243333-93243355 AACGGTGATTTAATTGGAATTGG - Intronic
1029193967 7:98791419-98791441 ACAGCTGATTCCATTGGACTTGG + Intergenic
1029977267 7:104846631-104846653 AAAGATGCTTTGATGGGAAGAGG - Intronic
1031093104 7:117386498-117386520 AAATCTGGTGTCCTTGGAATAGG - Intronic
1032330223 7:130971867-130971889 ATAGCTGCTGGCATTGGATTTGG - Intergenic
1032785212 7:135194954-135194976 ACCGCTGCTGTCTTTGGAATGGG - Exonic
1033494450 7:141880312-141880334 GAATTTGCTTTCATTTGAATGGG + Intergenic
1033846616 7:145440876-145440898 AAATCTGCTTTCAATGAAGTAGG + Intergenic
1034327405 7:150249203-150249225 AAATCTGCTACCATTTGAATTGG - Intronic
1034765803 7:153720242-153720264 AAATCTGCTACCATTTGAATTGG + Intergenic
1035318009 7:158009258-158009280 AGAACTGCTTGCATTTGAATTGG - Intronic
1037997532 8:23364221-23364243 GAAGCTGGTTGCATTGGAATCGG - Intronic
1038676545 8:29627994-29628016 AATGTTGCTTTCATTGGATCAGG + Intergenic
1043162842 8:76868210-76868232 AAAGCTGCTTTCATTGTATTAGG + Intergenic
1043288847 8:78570323-78570345 AAATCTGCTGTCATTTGAATTGG - Intronic
1043562590 8:81511720-81511742 ATAGCTGCTTTATTTGCAATAGG + Intergenic
1043596969 8:81898504-81898526 AAGGCTGCTTTGAGTGGGATTGG + Intergenic
1045150931 8:99406911-99406933 GAAGGTGCTTTCATTTGGATGGG + Intronic
1045335816 8:101203891-101203913 AAACCTGTTTCCATGGGAATAGG - Exonic
1045956854 8:107918348-107918370 AAATCTGTTTTCTTTGTAATGGG + Intronic
1046183562 8:110684098-110684120 AGAGCTGCTTTCTATGGAAGTGG - Intergenic
1047077152 8:121416877-121416899 AAATCTGCTGTCACTTGAATTGG - Intergenic
1048002096 8:130387117-130387139 AAACCTGCTTTCATATGAATTGG + Intronic
1048553646 8:135456188-135456210 AAAGCTGCCTCCATTTGCATTGG + Intergenic
1050059149 9:1687414-1687436 AAAGTGGCTGTCATTGGGATGGG + Intergenic
1053482993 9:38430045-38430067 CAAGCTGCTTCCATTGGCAAAGG - Intergenic
1055028197 9:71744820-71744842 AAAGCTATTTTCATTGGCTTTGG - Intronic
1055226929 9:74008339-74008361 TAGGCTGCTTTCATTGAAATAGG - Intergenic
1055374702 9:75636425-75636447 AAAGATACTTTCTTTGTAATAGG - Intergenic
1056839103 9:89983617-89983639 AAATCTGCTGTCATTTGAGTGGG - Intergenic
1058562204 9:106242043-106242065 AATGATGTCTTCATTGGAATGGG + Intergenic
1060558566 9:124523472-124523494 AATTCTGGTTTAATTGGAATGGG - Intronic
1187490309 X:19745081-19745103 AGACCTGCATTCATTGGATTTGG - Intronic
1188194052 X:27208730-27208752 AAAGCTTCATACATTTGAATAGG - Intergenic
1188290398 X:28380801-28380823 ATAACTTCTTTCATTTGAATAGG + Intergenic
1189823800 X:44896835-44896857 AAATTTGCTGTCATTTGAATTGG + Intronic
1189875861 X:45435049-45435071 AAATCTGCTGTCATTTGAATTGG + Intergenic
1191370184 X:59857035-59857057 AAACCCTCTTTCTTTGGAATCGG + Intergenic
1191451513 X:60945595-60945617 AAACCCTCTTTCTTTGGAATCGG + Intergenic
1191521399 X:61880725-61880747 AAACCCTCTTTCTTTGGAATCGG + Intergenic
1191553397 X:62308903-62308925 AAACCCTCTTTCTTTGGAATCGG + Intergenic
1192256427 X:69464179-69464201 AAATCTGCTGTAATTTGAATTGG + Intergenic
1192416444 X:70985179-70985201 AAATCTGCTCTCATTGCAATTGG - Intergenic
1192533377 X:71908647-71908669 AAAGCTGGTTTGCTTGGAATTGG + Intergenic
1193500225 X:82265550-82265572 AAAGCTGCATTTAATGAAATAGG + Intergenic
1194269476 X:91792814-91792836 ATAGTTGCTATCATTGGCATAGG - Intronic
1194371654 X:93080658-93080680 AAATCTGATTTTATTGGACTGGG - Intergenic
1195515932 X:105776004-105776026 AAAGCTAATTTCATGTGAATTGG - Intergenic
1195890922 X:109694301-109694323 AAAATTGCTTTCATTATAATAGG - Intronic
1195911682 X:109894791-109894813 AAATCTGCTGTAATTTGAATTGG + Intergenic
1196133039 X:112178254-112178276 AAAGCTGCTTACATGGGGCTGGG - Intergenic
1196253531 X:113489023-113489045 AAAGCAAGTTTCATGGGAATAGG - Intergenic
1196627853 X:117898112-117898134 AAAGCAGCTTCCATTAAAATGGG - Exonic
1198037557 X:132816740-132816762 AAAGTTGCTGTCTTTGGAGTTGG - Intronic
1198330712 X:135619834-135619856 AAAGCAGCTTTCAGGGGAAAAGG + Intergenic
1198891194 X:141398714-141398736 AAAGCTGGTTTGATTGTGATGGG + Intergenic
1199170422 X:144728533-144728555 AAATCTGCTTTTATTCTAATGGG - Intergenic
1199520630 X:148731298-148731320 TGAGTTGCTTTCATAGGAATGGG + Intronic
1199731164 X:150633526-150633548 AAAAATGCTTTCATTAAAATTGG - Intronic
1200586697 Y:5013793-5013815 ATAGTTGCTATCATTGGCATAGG - Intronic
1201528960 Y:14970779-14970801 AAAGCTGCTGACACTGGACTGGG + Intergenic
1201964521 Y:19717216-19717238 GTAGCTGCTTACATAGGAATTGG - Intronic