ID: 911430093

View in Genome Browser
Species Human (GRCh38)
Location 1:97774152-97774174
Sequence CCGTTGCATGCCCTGTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 7, 2: 30, 3: 96, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911430083_911430093 24 Left 911430083 1:97774105-97774127 CCCCTAGGGGTTTGAGCTTTGGG 0: 2
1: 12
2: 40
3: 138
4: 297
Right 911430093 1:97774152-97774174 CCGTTGCATGCCCTGTGAGGGGG 0: 1
1: 7
2: 30
3: 96
4: 283
911430086_911430093 22 Left 911430086 1:97774107-97774129 CCTAGGGGTTTGAGCTTTGGGAC 0: 1
1: 1
2: 14
3: 51
4: 241
Right 911430093 1:97774152-97774174 CCGTTGCATGCCCTGTGAGGGGG 0: 1
1: 7
2: 30
3: 96
4: 283
911430085_911430093 23 Left 911430085 1:97774106-97774128 CCCTAGGGGTTTGAGCTTTGGGA 0: 1
1: 1
2: 18
3: 51
4: 265
Right 911430093 1:97774152-97774174 CCGTTGCATGCCCTGTGAGGGGG 0: 1
1: 7
2: 30
3: 96
4: 283
911430081_911430093 25 Left 911430081 1:97774104-97774126 CCCCCTAGGGGTTTGAGCTTTGG 0: 2
1: 7
2: 31
3: 60
4: 174
Right 911430093 1:97774152-97774174 CCGTTGCATGCCCTGTGAGGGGG 0: 1
1: 7
2: 30
3: 96
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911430093 Original CRISPR CCGTTGCATGCCCTGTGAGG GGG Intronic
902511689 1:16970151-16970173 CCGTCGCCTGCTCTGTGAGTGGG + Intronic
903506431 1:23838730-23838752 CCCTCGCACGCCCTGAGAGGGGG + Intergenic
904451086 1:30612069-30612091 GCCTTGGATGCCCTGTGACGGGG + Intergenic
904577930 1:31517449-31517471 CCATTGCAGGCCCTGCGAGGGGG - Intergenic
905068585 1:35205648-35205670 CTGTTGCAAGTCCTGTGAAGTGG - Intergenic
905289657 1:36912571-36912593 CAAATGCAAGCCCTGTGAGGAGG - Intronic
905558650 1:38908592-38908614 CCATCGCACGCCCTGCGAGGGGG - Intronic
906657689 1:47560686-47560708 CCATTGTATGCTCTGGGAGGTGG - Intergenic
908842648 1:68294903-68294925 CCGTGGCACACCATGTGAGGGGG - Intergenic
908908789 1:69047867-69047889 CCATCACATGCCCTGCGAGGGGG + Intergenic
909491701 1:76233516-76233538 CCAGTGCATGCCCTTTGTGGTGG - Intronic
909837669 1:80276935-80276957 CTGTTGCATATCCTGTGATGGGG + Intergenic
911430093 1:97774152-97774174 CCGTTGCATGCCCTGTGAGGGGG + Intronic
912002710 1:104855685-104855707 CCATTGCATGCCCTTCAAGGGGG - Intergenic
913511706 1:119568512-119568534 CCATTGCATGCTTGGTGAGGGGG - Intergenic
913515936 1:119605841-119605863 TCATTGCATGCCTGGTGAGGGGG - Intergenic
915510206 1:156382792-156382814 CTGGTGCATGGCCTGTGACGTGG - Exonic
915731329 1:158056379-158056401 CCTTGCCCTGCCCTGTGAGGAGG - Intronic
916809215 1:168291051-168291073 CCACGGAATGCCCTGTGAGGAGG - Intronic
917254802 1:173103237-173103259 CTGTTGCACACCCTGTGAGGCGG - Intergenic
918024731 1:180732552-180732574 CCATTGCACACCCTGTGAGGGGG - Intronic
921785962 1:219229782-219229804 TCATCGCATGCCCTGCGAGGGGG + Intergenic
922033472 1:221826093-221826115 CTGTTGCATGTTCTGTGAGGGGG + Intergenic
922700002 1:227753736-227753758 CTGTTGAATGCCCTGTGAGGGGG - Intronic
923383722 1:233446675-233446697 CCATCGCAGGCCCTATGAGGGGG - Intergenic
1063357688 10:5416700-5416722 CCAGTGCACGCCCTGCGAGGGGG - Intronic
1063523466 10:6761503-6761525 CCATTGCATGCCCTGAGAAGGGG + Intergenic
1063627324 10:7702266-7702288 CTGTTGCATGCCCTGTGAATTGG + Intergenic
1064274988 10:13897581-13897603 CCAGTGCATGGCCTGTGAGTTGG + Intronic
1065011672 10:21426839-21426861 CTGTTGCACGTCCTGCGAGGAGG - Intergenic
1066265819 10:33774751-33774773 CTGTTGCACCCCCTGTGAGGGGG + Intergenic
1068258392 10:54543481-54543503 CCAACGCATGCCCTGCGAGGAGG + Intronic
1068309819 10:55263031-55263053 CCATCACATGCCCTGTGATGGGG + Intronic
1068310429 10:55267044-55267066 CCATCGCATGCACTGTGAGGAGG + Intronic
1068429445 10:56912906-56912928 CCATCGCATGCCCTGCGAGGGGG - Intergenic
1068607984 10:59026650-59026672 CCATCACATGCCCTGTGAGGGGG + Intergenic
1069209138 10:65733962-65733984 CCACTGCATGCTCTATGAGGGGG + Intergenic
1069222696 10:65903933-65903955 CCATTGCACACCCTGAGAGGGGG + Intergenic
1070284339 10:75072399-75072421 CCGTCGCATGCCCTGTGAGAGGG + Intergenic
1070380654 10:75877935-75877957 CTGTTGCATGCCCTGTGAGGGGG - Intronic
1070466840 10:76732479-76732501 ACTTTGCATGCCCTGTGAGATGG - Intergenic
1071011324 10:80944210-80944232 CTGTTGCACGTTCTGTGAGGGGG - Intergenic
1071028193 10:81140337-81140359 CTGCTGCACACCCTGTGAGGGGG + Intergenic
1071195484 10:83153962-83153984 CTGTGGCACGCCCTGTGAGGGGG + Intergenic
1071353154 10:84767068-84767090 CCATCGCACACCCTGTGAGGAGG - Intergenic
1072357450 10:94625077-94625099 CTGTTGCACGTCCTGAGAGGGGG + Intergenic
1075331107 10:121574606-121574628 CCTTTGCATGCCCTGCCATGAGG + Intronic
1076306141 10:129467014-129467036 TCGGCGCATGCCCTGTGCGGCGG - Intergenic
1076738168 10:132467964-132467986 CCGTGGCTGGCCCTGGGAGGGGG - Intergenic
1077197373 11:1288203-1288225 CCAATGCCTGCCCTGTGGGGAGG + Intronic
1078022150 11:7665030-7665052 CCGTGGCCTGGCCTGTGAGTTGG - Intergenic
1079767040 11:24406640-24406662 CCACTGCATGAGCTGTGAGGGGG + Intergenic
1081232946 11:40607971-40607993 CTGTTGCATGCCCTGCGAGGGGG + Intronic
1081342625 11:41947127-41947149 CCATCACATGCCCTGTGAGGGGG - Intergenic
1081914128 11:46719991-46720013 CTCTTGCCAGCCCTGTGAGGAGG - Intronic
1083388734 11:62332846-62332868 CTGTTGCATGCCCTGCAAGGGGG - Intergenic
1083482972 11:62961556-62961578 CCTTTGGATGCTGTGTGAGGGGG + Intronic
1083844296 11:65321879-65321901 CCGTTGGATGCCCTGACTGGGGG + Exonic
1084926982 11:72521905-72521927 CTGTCACATGCCCTGTTAGGGGG - Intergenic
1084942116 11:72618438-72618460 CCCTTGCTTGCTCTGTGAGGGGG - Intronic
1085051236 11:73381348-73381370 CCAGTGCATGCACTGTGAGGAGG + Intronic
1085684135 11:78606181-78606203 CCATCGCATGCCCTGGGAGGGGG + Intergenic
1086001907 11:81993439-81993461 ATGTTGCATGCCGTGTGAGAGGG + Intergenic
1086311564 11:85540871-85540893 CTGTTGCACGCCCTGCGAGGAGG + Intronic
1086395643 11:86412726-86412748 CCACTGCATGCCCTGCGAGGGGG - Intronic
1087139951 11:94755635-94755657 CTGTCGCAGGCCCTGTGACGGGG - Intronic
1087677149 11:101176042-101176064 CTATCACATGCCCTGTGAGGGGG + Intergenic
1087781934 11:102310402-102310424 CTGTCGCAAGCCCTGCGAGGGGG + Intergenic
1087816534 11:102664593-102664615 CCATTGCATGCCCCATGAGGGGG + Intergenic
1087934253 11:104013551-104013573 CTGTTGCAAGTCCTGTGAAGGGG + Intronic
1088103299 11:106177575-106177597 CCATTGCACGCCCTGTGAGGGGG + Intergenic
1088220945 11:107569773-107569795 CCGCTGCACGCCTTGCGAGGGGG - Intergenic
1088257807 11:107917168-107917190 CTGTTGCATGCCCTGTGAGGGGG + Intronic
1088448340 11:109955515-109955537 CTGTTGCATGTCCTGCTAGGGGG + Intergenic
1088450687 11:109978105-109978127 CTGTTGCATGTCCTGCAAGGGGG + Intergenic
1088802727 11:113320841-113320863 CTGTCGCATGTCCTGCGAGGGGG + Intronic
1089030978 11:115329442-115329464 CTGTTGCATGTCTTGTGAGGGGG - Intronic
1089122683 11:116148352-116148374 CCGTCTCACGCCTTGTGAGGAGG + Intergenic
1090124232 11:124069476-124069498 CCTTCGCACACCCTGTGAGGGGG - Intergenic
1092262775 12:6961331-6961353 CCTTTGCTTGCCCAGTGAGTGGG + Intergenic
1093156238 12:15689028-15689050 ACATTGCATGCCCTGCGAGGGGG + Intronic
1093348891 12:18072267-18072289 CTGTCTCATGCCCTGTGAGAGGG - Intergenic
1094461130 12:30697210-30697232 CCAATGCACGCCCTGTGAGGGGG + Intergenic
1094586627 12:31782768-31782790 CCATTGCATGCTCTGCGAGGGGG + Intergenic
1094848471 12:34371820-34371842 CCCTTGCATGCACGGTGGGGAGG + Intergenic
1094854874 12:34398485-34398507 CCCGTGCATGCCCAGTGGGGAGG - Intergenic
1095448158 12:42302876-42302898 CTGTCGCATGTCCTGTGAGGGGG - Intronic
1095898552 12:47305119-47305141 CCGTCACACACCCTGTGAGGGGG - Intergenic
1096171722 12:49476676-49476698 CCACTGCATGCCCTGTGAGGGGG + Intronic
1096414368 12:51400971-51400993 TTGTTGCACTCCCTGTGAGGGGG - Intronic
1096933580 12:55242846-55242868 CCATCGCATGCCCTGTGAGGGGG + Intergenic
1097131069 12:56810990-56811012 CTGTCACACGCCCTGTGAGGAGG - Intergenic
1099055332 12:77833425-77833447 CTGTCACATGCCCTGTGAGGGGG - Intronic
1099653348 12:85457114-85457136 ATGTTGCATGCCCTGAGAAGGGG + Intergenic
1100206441 12:92354789-92354811 CTGTTGCATGTCCCATGAGGGGG + Intergenic
1101455814 12:104828639-104828661 CCATCACATGCCCTGTGAGGGGG + Intronic
1105595011 13:21828680-21828702 CCATCACATGTCCTGTGAGGAGG + Intergenic
1105682576 13:22744698-22744720 CCATCGCATGCCCTGCAAGGGGG - Intergenic
1106169918 13:27280105-27280127 CCGTCACATGCCCTGTGAGGGGG + Intergenic
1106319511 13:28624675-28624697 CCGCTGCACACCTTGTGAGGGGG + Intergenic
1108297354 13:49037689-49037711 CTGTTGCATGTACTGTGAGGGGG - Intronic
1108519675 13:51234976-51234998 CAGTTCCATGATCTGTGAGGTGG - Intronic
1109152375 13:58860552-58860574 CCATCGCAAGCCCTGCGAGGGGG - Intergenic
1109958753 13:69603397-69603419 CTGTCACATGCTCTGTGAGGGGG + Intergenic
1111584518 13:90267935-90267957 CCATCGTGTGCCCTGTGAGGGGG - Intergenic
1112814083 13:103251795-103251817 TCATTGCATGCCCTGTGAAGGGG - Intergenic
1113594450 13:111521240-111521262 CCCCTGCGTGCCCTGTGGGGTGG + Intergenic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1115123938 14:29970857-29970879 CCATCGCACGCCCTGCGAGGGGG - Intronic
1115709801 14:36038668-36038690 CCTTAGCATTCCCTGTGAGGTGG + Intergenic
1116712184 14:48383017-48383039 CTGTTGCAAGTCCTGTGAAGGGG - Intergenic
1119023735 14:71136561-71136583 CTGTTGCACGTCCTGCGAGGGGG - Intergenic
1119350621 14:73961747-73961769 CTGTTTCATAACCTGTGAGGTGG - Exonic
1119520574 14:75281407-75281429 ACGCTGCTGGCCCTGTGAGGGGG + Exonic
1121104277 14:91270692-91270714 CCATTGCATGCCCCCTGTGGTGG + Intergenic
1121172621 14:91867754-91867776 CTGTTGCACATCCTGTGAGGGGG - Intergenic
1122945676 14:105007688-105007710 CCTTCTCATGCCCTGTGTGGAGG - Intronic
1123809013 15:23904907-23904929 ACATCGCATGCCCTGAGAGGGGG - Intergenic
1123921124 15:25070591-25070613 CCTGTGGATGCCCTGGGAGGTGG - Intergenic
1126228360 15:46296829-46296851 CCATTGCATGCCCTGCAAGGGGG + Intergenic
1126278934 15:46919319-46919341 CCATCGCATGCCCTGTGAGGGGG + Intergenic
1126744961 15:51817223-51817245 CTGTCGCATGCCCTGCAAGGGGG - Intergenic
1127142682 15:55993589-55993611 CAGTTGCCTGCCCTGGGCGGGGG - Intronic
1128046004 15:64618259-64618281 CCATTGCACGCCCTGTGAGGGGG - Intronic
1130430525 15:83842515-83842537 CTGTTGCATGCCCTGAGAGGGGG + Intronic
1130927284 15:88395321-88395343 TGATGGCATGCCCTGTGAGGGGG - Intergenic
1131557678 15:93413877-93413899 CTGTTGCACGCCCTGCGAGGGGG - Intergenic
1134535938 16:15027229-15027251 CCATCACATGCCCTGCGAGGGGG - Intronic
1134911782 16:18033824-18033846 CCTGTGCATGGCCAGTGAGGAGG - Intergenic
1134913533 16:18050389-18050411 CTGCTGCATGCCTTGTGAGAGGG - Intergenic
1135121060 16:19767049-19767071 CTGTTGCATGCCCTGCGAGGGGG - Intronic
1135565545 16:23508855-23508877 CAGATGCCTCCCCTGTGAGGAGG - Intronic
1135887846 16:26328704-26328726 CCTTTGCATGTCCTGTGAAGGGG - Intergenic
1138501465 16:57447565-57447587 GCGATGCCTGCCCGGTGAGGGGG + Exonic
1138808551 16:60121342-60121364 CCATCGCATGCCCTGCGAGGGGG + Intergenic
1139064254 16:63292296-63292318 CTGTCGCATGCCCTGCGAGGGGG + Intergenic
1139284515 16:65798444-65798466 CTGTCCCAAGCCCTGTGAGGAGG + Intergenic
1139860117 16:70013558-70013580 CCATCACATGCCCTGCGAGGGGG + Intergenic
1141113474 16:81289017-81289039 CCTTTACATTCTCTGTGAGGAGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1144667733 17:17113074-17113096 CTGTTTCATGCCCTGGGGGGTGG + Intronic
1145761635 17:27429028-27429050 CCCTTGAGAGCCCTGTGAGGGGG - Intergenic
1145942094 17:28747890-28747912 CCGCTGCATCCACAGTGAGGAGG + Exonic
1146161685 17:30563189-30563211 CCCTTGAGGGCCCTGTGAGGGGG - Exonic
1147567882 17:41548702-41548724 CCTCTGAATGCCCGGTGAGGTGG - Intergenic
1149206359 17:54253127-54253149 CTGTTGCATGTCCTGCGAGGGGG - Intergenic
1150855211 17:68745661-68745683 CTGTTTCATGCCCTGCAAGGGGG + Intergenic
1152335305 17:79697230-79697252 CTGTCACACGCCCTGTGAGGGGG + Intergenic
1153608431 18:6857271-6857293 CTGTTGCATATCCTGTGTGGAGG + Intronic
1153960207 18:10133935-10133957 CCATTGCACGCCCTGTGAGGAGG - Intergenic
1156084607 18:33383148-33383170 CCTGTCCATGCCCAGTGAGGAGG - Intronic
1157002304 18:43541943-43541965 CTGTTGCATGCCCTGCAAGGAGG - Intergenic
1158675228 18:59512442-59512464 CTGCTGCATGCCCTGCAAGGGGG + Intronic
1159345699 18:67200796-67200818 CTATCGCATGCCCTGCGAGGGGG - Intergenic
1159417541 18:68172878-68172900 CTGTTGCACACCCTGTGAGGGGG - Intergenic
1167367832 19:49064224-49064246 CCCTGGCCTGTCCTGTGAGGAGG - Intronic
925424824 2:3739993-3740015 CCATTGCACGCTCTGCGAGGGGG + Intronic
925424948 2:3741560-3741582 CCATCTCATGCTCTGTGAGGGGG + Intronic
925572280 2:5325221-5325243 CCATCGCATGCCCTATGAGGGGG - Intergenic
925771867 2:7289825-7289847 CTGATGAGTGCCCTGTGAGGAGG - Intergenic
925806709 2:7658211-7658233 CCATTGCATGCCCTGTGAGGGGG - Intergenic
926139338 2:10359131-10359153 CCATCACATGCCCTTTGAGGGGG + Intronic
929576108 2:43053563-43053585 CCGTTGCCTGCTCTGGGATGGGG - Intergenic
930398124 2:50848233-50848255 CCATCGCACGCCCTGCGAGGGGG + Intronic
930704513 2:54490942-54490964 CTCTTGCATGCCTTGAGAGGAGG + Intronic
930763706 2:55062505-55062527 CTATCGCATGCCCTGAGAGGGGG + Intronic
931034692 2:58227082-58227104 CCATCGCATGCCCTGCAAGGGGG - Intronic
933315273 2:80707169-80707191 CCATCACATGCCCTGTGAGAGGG + Intergenic
933398889 2:81766008-81766030 CCATCACATGACCTGTGAGGGGG + Intergenic
934745899 2:96759680-96759702 CAGCTGCCCGCCCTGTGAGGGGG - Intergenic
935117263 2:100147227-100147249 CCGAAGCATGCCCTGTGATTGGG + Intergenic
935876667 2:107515001-107515023 TCATTGCACGCCCTGTGAGGGGG - Intergenic
935882270 2:107576292-107576314 CTGTCACATGCCCTGCGAGGGGG + Intergenic
938030293 2:127986365-127986387 CTGTTGCACGCCCTGCGAGGGGG + Intronic
939356846 2:141114075-141114097 CTGTGGCAAGTCCTGTGAGGGGG - Intronic
940360551 2:152791465-152791487 CCATTGCACGCCCTGCGAGGGGG + Intergenic
940478011 2:154191664-154191686 CCACTGCACGCCCTGTGAGGGGG - Intronic
940729763 2:157375468-157375490 CAGTTTCATGCCCTGCTAGGCGG + Intergenic
942708033 2:178799390-178799412 GCGTCGCATGCCCTGCGAGGGGG + Intronic
943474709 2:188340352-188340374 CTGTTGCAAGGCCTGTGAAGGGG - Intronic
944306935 2:198189244-198189266 GCATCGCATGCCCTGTGAGGGGG + Intronic
944512255 2:200476494-200476516 CTGTTGCAAGGCCTGTGAAGGGG - Intronic
945586635 2:211673163-211673185 CCGGTCCATGGCATGTGAGGAGG + Exonic
946392709 2:219426167-219426189 CCGGGGCATGCCCTGTGACCAGG - Exonic
946712224 2:222517825-222517847 CTGTTGCACGTCCTGTGAAGGGG + Intronic
946875630 2:224126782-224126804 CCGTAGCCTGTTCTGTGAGGAGG - Intergenic
947326261 2:228981540-228981562 CCGTAGCATGAACTGAGAGGTGG + Intronic
947592701 2:231394610-231394632 CCGTTTCCTCCCCTGTAAGGTGG + Intergenic
947906285 2:233765842-233765864 CTGTCACATGCTCTGTGAGGGGG - Intronic
948888883 2:240897299-240897321 CCGTGGGCTACCCTGTGAGGTGG - Intergenic
1170270912 20:14526682-14526704 CCACCACATGCCCTGTGAGGGGG - Intronic
1170485915 20:16816336-16816358 CCATCGCAGGCCCTGTGAAGGGG - Intergenic
1171384151 20:24756404-24756426 CTGTTGCATGCCCTGTGAGGGGG - Intergenic
1172676326 20:36675345-36675367 CCGTTGCGGGCCAGGTGAGGTGG - Intronic
1173491885 20:43489355-43489377 CTGTCGCATGTCCTGGGAGGGGG - Intergenic
1174028718 20:47603292-47603314 CTGTCGCACGTCCTGTGAGGGGG - Intronic
1174126608 20:48311228-48311250 CCATTCCACGCCCTGTGAGGGGG - Intergenic
1174432164 20:50478368-50478390 CCATCGCATGCCCTTCGAGGAGG - Intergenic
1175511337 20:59528203-59528225 CCATGGCCCGCCCTGTGAGGGGG + Intergenic
1177339587 21:19782513-19782535 CGATTGCATGCCTTGCGAGGGGG + Intergenic
1177639841 21:23832878-23832900 CCATTGCACGCCCTGCGAGGGGG - Intergenic
1178094359 21:29197814-29197836 CTGTTGCATGTCCTGCGAGAGGG + Intronic
1178660795 21:34505874-34505896 CCTTTGCTTGTCCTGGGAGGTGG - Intergenic
1179095974 21:38314631-38314653 CTGTTACATGCCCTGCAAGGGGG + Intergenic
1179131738 21:38643665-38643687 CCGATGCATTCCCGGTGGGGCGG - Intronic
1180892023 22:19296380-19296402 CCATCGCATGCCCTGCAAGGGGG - Intergenic
1180930321 22:19586223-19586245 CCATCGCCTGCCCTGCGAGGGGG - Intergenic
1181040672 22:20191145-20191167 CCATTGCATGCCCTGCGAAGGGG + Intergenic
1181451602 22:23026436-23026458 CCATTGCATGCCCTGAGAGGGGG - Intergenic
1182994775 22:34801852-34801874 CTATCACATGCCCTGTGAGGGGG + Intergenic
1183317704 22:37145996-37146018 CAGGAGCATCCCCTGTGAGGGGG - Intronic
1184297030 22:43531323-43531345 TCGTTGCATTCCCTGGGAGGTGG - Intronic
949808095 3:7977111-7977133 CTGTCACATGCCCTGTGAGGGGG + Intergenic
952183613 3:30944999-30945021 CCTTTGCATGCTCTGTGATAAGG + Intergenic
952298723 3:32085290-32085312 CCATCACATGCCCTGTGAGGGGG - Intergenic
953753783 3:45629867-45629889 CCATTGCACACCCTGTGAGAGGG + Intronic
954736518 3:52712296-52712318 CCATTGCACGCCCTGCGAGGGGG - Intronic
954922405 3:54203250-54203272 CCATCGCACGCCCTGCGAGGGGG - Intronic
956194178 3:66635441-66635463 CCATCACATGCCGTGTGAGGGGG + Intergenic
957029212 3:75221020-75221042 CTGTCGCACACCCTGTGAGGGGG - Intergenic
957057948 3:75458770-75458792 CCATCGCATGCCCTTCGAGGGGG - Intergenic
957991113 3:87628222-87628244 CCATCACATGCCCTGCGAGGGGG + Intergenic
958024018 3:88028819-88028841 CCTTTGCAAGTCCTGTGAAGGGG + Intergenic
958632364 3:96700361-96700383 CCATAGCATGCCCTGCAAGGGGG + Intergenic
958978884 3:100697446-100697468 CTGTCACATGCCCTGTGACGGGG + Intergenic
959269667 3:104191975-104191997 CCATCGCATGCCTGGTGAGGGGG - Intergenic
959369325 3:105504135-105504157 CTGTCGCATGCCCTGTGAGGGGG - Intronic
959583508 3:108004817-108004839 CCATCACATGCCCTGCGAGGGGG + Intergenic
959839505 3:110958501-110958523 CTGTCACATGTCCTGTGAGGAGG - Intergenic
960878002 3:122315838-122315860 CTGTCACACGCCCTGTGAGGGGG + Intergenic
961343663 3:126247116-126247138 CTGTCACATGTCCTGTGAGGGGG - Intergenic
961880286 3:130056868-130056890 CAGTAGCATGCCCTGCAAGGGGG + Intergenic
961890399 3:130126231-130126253 GCATTGCATGCCCTTCGAGGGGG - Intergenic
962742117 3:138369534-138369556 GCATTGAATGTCCTGTGAGGGGG + Intronic
963996949 3:151721040-151721062 CCATCGCACACCCTGTGAGGGGG - Intergenic
965085391 3:164089113-164089135 CTGTTGCAAGTCCTGTGAGGGGG + Intergenic
965320526 3:167247732-167247754 TCATTGCATGCCCTGCAAGGGGG + Intronic
965321082 3:167251524-167251546 CCATCGCACGCCCTGTGAGGGGG + Intronic
965534892 3:169813470-169813492 CCATCGCATGCCCTGCAAGGGGG - Intergenic
966285714 3:178293396-178293418 CCATTGCACGCCCTGCGAGGTGG - Intergenic
968271617 3:197407638-197407660 CCGAAGCCTGCCCTGTGAAGAGG + Intergenic
968598499 4:1497720-1497742 CTGTTGCATGTCCTGTGAGGGGG - Intergenic
969139036 4:5052903-5052925 CCTTTTCATGCCCCTTGAGGTGG + Intronic
970054587 4:11956866-11956888 CCATCGCGTGCCCTGTGAGGGGG - Intergenic
970244956 4:14051126-14051148 CCGTTGCACCCCATGTGAGTGGG + Intergenic
970273098 4:14368130-14368152 CCATCGCACACCCTGTGAGGGGG - Intergenic
970503436 4:16702599-16702621 CCCTTGCAGACCCTGTGATGTGG + Intronic
970574188 4:17411669-17411691 CCATTGCATGCCCTGCAACGGGG - Intergenic
971742619 4:30539813-30539835 CTGTCGCATGTCCTGCGAGGCGG - Intergenic
972104456 4:35463882-35463904 CTGTTGCAGGCCCTGCGAGGGGG + Intergenic
972917919 4:43903724-43903746 CCATCGCATGCCCTGCAAGGGGG + Intergenic
973936241 4:55849857-55849879 CCATCGCATGCCCTGCGATGGGG - Intergenic
974012210 4:56617470-56617492 CCAATGCATGCCCTATAAGGGGG - Intergenic
974610051 4:64205762-64205784 CTGTTGCACGTCCTGCGAGGGGG - Intergenic
976070577 4:81235723-81235745 CCATCACATGCGCTGTGAGGGGG - Intergenic
976413332 4:84742553-84742575 CCGTTCCATGGCCTGGGAGTTGG - Intronic
977619575 4:99120790-99120812 CTGTTGCACATCCTGTGAGGGGG + Intergenic
977757002 4:100683139-100683161 CCATTCCACGCCCTGCGAGGGGG + Intronic
977766544 4:100805670-100805692 CCATCGCACACCCTGTGAGGGGG - Intronic
978327473 4:107575515-107575537 CCAGCACATGCCCTGTGAGGGGG + Intergenic
979055127 4:115983990-115984012 CCGGTCCATGCCCTGTTAGGAGG + Intergenic
979392353 4:120141795-120141817 CCGTCACATGTCCTGTGATGGGG + Intergenic
979862065 4:125706934-125706956 CCATTGCATGCCCTTCAAGGGGG - Intergenic
980100631 4:128538536-128538558 CCCTTGCACGCCCTGCAAGGGGG - Intergenic
980438367 4:132809908-132809930 CTGTCACAAGCCCTGTGAGGGGG + Intergenic
980821468 4:138022830-138022852 CTGTTGCAAGTCCTGAGAGGGGG - Intergenic
981317145 4:143350942-143350964 CCATTGCATGCCCTGCGAGGGGG - Intronic
981373564 4:143987711-143987733 GTGTTGCATGTCCTGTGAGTTGG + Intergenic
981423868 4:144581457-144581479 CCATTGTATGCCCTGTGAAGGGG + Intergenic
982504497 4:156199263-156199285 CTATCACATGCCCTGTGAGGGGG + Intergenic
982774500 4:159427927-159427949 CTGTTGCATGTCCTGTGAGGGGG + Intergenic
984081315 4:175252875-175252897 CTGTCACATGCCCTGCGAGGGGG + Intergenic
984272006 4:177558394-177558416 CCATCACATGCCCTGCGAGGGGG + Intergenic
985228213 4:187785041-187785063 CTGTCACATGCCCTGAGAGGGGG + Intergenic
985271491 4:188197958-188197980 GTGTTGCACGCCATGTGAGGGGG + Intergenic
985293251 4:188407379-188407401 CTGTCGCATGTCCTGTGAGGGGG + Intergenic
986345735 5:6833658-6833680 CCTCTTCCTGCCCTGTGAGGCGG - Intergenic
986364707 5:7018957-7018979 CCATCACATGCCCTGAGAGGGGG - Intergenic
987005772 5:13707619-13707641 CTGTCACACGCCCTGTGAGGGGG + Intronic
987251844 5:16108356-16108378 CTGTCGCATGTCCTGCGAGGGGG + Intronic
988087097 5:26485984-26486006 CAGTGGCATGTCCTGCGAGGGGG + Intergenic
991087524 5:62661455-62661477 CTGTTGCATGTTCTGCGAGGAGG + Intergenic
991196435 5:63939471-63939493 CCATCACATGCCCTGCGAGGGGG + Intergenic
992038243 5:72802816-72802838 ACATTGCATGACCTGAGAGGGGG + Intergenic
992992423 5:82298065-82298087 CTGTTGCATGTCCTGCAAGGGGG - Intronic
994531855 5:100982361-100982383 CTGTTGCATGTCCTGTGAGGGGG + Intergenic
994929574 5:106163864-106163886 CCATCGCACGCCCTGTGAGGGGG + Intergenic
996099988 5:119436126-119436148 GCCTTGCCTGCCCTGGGAGGTGG - Intergenic
996215109 5:120856559-120856581 CTGTCGCATGCCCTGCAAGGGGG + Intergenic
996486652 5:124042622-124042644 CCATTGGATGCCCTGTGAAGGGG + Intergenic
996536680 5:124585129-124585151 CTGTTACATGTCCTATGAGGGGG - Intergenic
996669470 5:126100590-126100612 CTGTTGCATATCCTGGGAGGGGG - Intergenic
998356447 5:141540770-141540792 CCATTTCAGGCCCTGTGTGGTGG + Intronic
1000664519 5:163979024-163979046 CTGTAGCATGTTCTGTGAGGAGG - Intergenic
1001181206 5:169522234-169522256 CCATTGCACACCCTGCGAGGGGG + Intergenic
1002435051 5:179226097-179226119 CCATAGCACGCCCTGCGAGGAGG + Intronic
1002476933 5:179472329-179472351 CTGTCACATGCCCTGTGAGGAGG - Intergenic
1003053229 6:2798287-2798309 CTGCTGCATGCCCGGTGATGTGG + Intergenic
1003593217 6:7453105-7453127 CTGTCACATGCCCTGTGAGGGGG + Intergenic
1004314269 6:14572374-14572396 CCGTTGCAAGGCCTTTGAGGTGG + Intergenic
1004417195 6:15435949-15435971 CCATCGCACGCCCTGAGAGGGGG - Intronic
1004746250 6:18511582-18511604 CTGTCGCATGCCCTGCGTGGGGG + Intergenic
1005712262 6:28513472-28513494 CCGTCGCATGCCTTGTGAGAGGG + Intronic
1005794696 6:29347608-29347630 CCATCGCATGCCCTGCGAGGGGG - Intergenic
1006208985 6:32376405-32376427 CTGTTGCAAGCCCTGTGAGGGGG + Intergenic
1006731083 6:36236517-36236539 CCATTGCATGCCCAGCGAGGGGG + Intergenic
1007854966 6:44846136-44846158 CCACTGCATGCCCTGTGAGGGGG + Intronic
1009404025 6:63291075-63291097 CTGTTGCATGCTCCGCGAGGAGG - Intronic
1010995215 6:82524276-82524298 CCATCGCATGCCCTGTGAGGGGG + Intergenic
1011326250 6:86152187-86152209 CCATCACATGCCCTGGGAGGGGG - Intergenic
1012440264 6:99255545-99255567 CCATCACATGCCCTGCGAGGGGG + Intergenic
1012606874 6:101168288-101168310 CCATTGCATGCCCTGTGAGGGGG + Intergenic
1014247189 6:119081327-119081349 CCATTGCACGCCCTGCGAAGGGG - Intronic
1014323866 6:119966740-119966762 CCGTCGCATGCCCTGCAAGAAGG + Intergenic
1014620390 6:123660506-123660528 CTGTTGCACACCATGTGAGGGGG - Intergenic
1017980203 6:159394547-159394569 CCATCACATGCCCTGTGAGGGGG + Intergenic
1018258054 6:161941770-161941792 CCATGACATGCCCTGGGAGGAGG + Intronic
1018900356 6:168048825-168048847 CAGCTGCACGCCCTGTGATGGGG - Intergenic
1020315326 7:6901579-6901601 CTGTAGCATGCCCTGCAAGGGGG + Intergenic
1021082983 7:16385781-16385803 CTGTTGCAGGTCCTGTGAGGGGG - Intronic
1023754400 7:43402412-43402434 CTGTTGCATGTCCTGTGAGGGGG + Intronic
1024093225 7:45964819-45964841 CTGTTGAATACCCTGTGGGGAGG - Intergenic
1024265177 7:47600837-47600859 CCATCACATGCCCTGTGAAGAGG + Intergenic
1024267738 7:47619659-47619681 CCATCACATGCCCTGCGAGGGGG + Intergenic
1024440329 7:49408788-49408810 CCATTGCATGCCCTGCAAGGGGG + Intergenic
1024633070 7:51265040-51265062 CTGTTGCATGCCCCTTCAGGAGG - Intronic
1027569621 7:79847589-79847611 CTGTTGCATGCCCTGCGCGGGGG + Intergenic
1027932332 7:84553138-84553160 CCATCACATGCCCTGCGAGGGGG + Intergenic
1028724362 7:94070799-94070821 CTGTCACACGCCCTGTGAGGGGG - Intergenic
1029038713 7:97550105-97550127 CCATCGCTTGCCCTGCGAGGGGG + Intergenic
1030746606 7:113173318-113173340 CCATCGCACGACCTGTGAGGGGG + Intergenic
1030794356 7:113769927-113769949 CCATTGCATGCCCTACTAGGAGG - Intergenic
1031765691 7:125773684-125773706 CTGTCGCATGCCCTGCTAGGGGG + Intergenic
1033675521 7:143537618-143537640 CCATTGCATCCCCTGTGACTTGG - Intergenic
1033696316 7:143791826-143791848 CCATTGCATCCCCTGTGACTTGG + Intergenic
1034099214 7:148436952-148436974 CTGTCACACGCCCTGTGAGGGGG - Intergenic
1036917757 8:12821199-12821221 ATGTCTCATGCCCTGTGAGGGGG - Intergenic
1037226851 8:16602612-16602634 CTGTCACATGCCCTGGGAGGGGG + Intergenic
1039306955 8:36273137-36273159 CCATTGCATGCCCTGCAAGGGGG + Intergenic
1040602296 8:48896994-48897016 CTGTCCCACGCCCTGTGAGGGGG - Intergenic
1040782179 8:51122170-51122192 CCATCGCATGCCCTGCGAGGGGG + Intergenic
1041219327 8:55633298-55633320 TCATTGCCTGCCCTGTGATGGGG + Intergenic
1041586314 8:59523849-59523871 CCGTCACATACCCTGTGAGGGGG + Intergenic
1042601381 8:70502827-70502849 CTGTTGCAAGTCCTGTGAGGGGG - Intergenic
1043238396 8:77899343-77899365 CCATTGCACACCCTGTGAGTGGG - Intergenic
1043599871 8:81923958-81923980 CCGTTGCATGCCGTGTGAGGGGG + Intergenic
1044085281 8:87936072-87936094 CCATCGCATGCCCTGTGATGGGG - Intergenic
1044448106 8:92302049-92302071 CTGTCACATGTCCTGTGAGGGGG - Intergenic
1046250404 8:111623874-111623896 CCATCGCATGCCCTGCGAGGGGG - Intergenic
1046260941 8:111766383-111766405 CCATTGCACACACTGTGAGGAGG + Intergenic
1046582583 8:116111233-116111255 CTGTTGCAAGTCCTGCGAGGGGG + Intergenic
1046870101 8:119196766-119196788 CCATCGCATGCCCTATGAGGGGG - Intronic
1047079258 8:121442300-121442322 CCATCGCATCCCCTGTGAAGGGG - Intergenic
1047202046 8:122775617-122775639 TCATTGCATGCCCTGCGAGGGGG - Intergenic
1047586585 8:126280068-126280090 CTGTTGCACACCCTGTGAGGGGG + Intergenic
1048082909 8:131148519-131148541 CCATCACATGCCCTGTGAGGGGG - Intergenic
1048135083 8:131740472-131740494 CCATCGCACGCCCTGAGAGGGGG + Intergenic
1048671658 8:136729928-136729950 CCATTGCACGCCCTGCAAGGGGG - Intergenic
1048680045 8:136831511-136831533 CCGTCTCATGTCCTGTGAAGGGG - Intergenic
1049321532 8:141999439-141999461 CGGTAGCATTCCCTGTGGGGTGG + Intergenic
1049384578 8:142335432-142335454 CCGTATCATGTCCTGTGTGGTGG - Intronic
1050479361 9:6073749-6073771 CCATTGCATGCCCTGCGAGGGGG + Intergenic
1051887115 9:21904911-21904933 CCGTCACATACCCTGTGAGAAGG - Intronic
1052566476 9:30160164-30160186 CGGTTGCACACCCTGTGAGAGGG - Intergenic
1052690133 9:31807568-31807590 CCATCACATGCTCTGTGAGGGGG - Intergenic
1052793723 9:32902696-32902718 CTGTCGCATGTCCTGTGAGTGGG + Intergenic
1052795673 9:32921557-32921579 CTGTTGCATGTCCTGTGAGGGGG - Intergenic
1054912273 9:70465554-70465576 CCATGGCATGCTCTGCGAGGGGG - Intergenic
1055054314 9:72010189-72010211 CCATCGCATGCCCTGTGAGGGGG - Intergenic
1055199755 9:73646191-73646213 CCAGTGCATGCCCTGTGAGGGGG - Intergenic
1055243990 9:74218370-74218392 CCATCACATGCCCTGTGAGGAGG + Intergenic
1056327425 9:85491278-85491300 CCATCACATGCCCTGCGAGGGGG + Intergenic
1056377516 9:86028810-86028832 CCATTGCATGCCCTGTGAAGGGG + Intronic
1056573221 9:87834443-87834465 CCATCACATGCCCTGCGAGGGGG - Intergenic
1058339121 9:103872886-103872908 CCATTGCACGCCCTGTAATGGGG - Intergenic
1058584408 9:106491888-106491910 CCATTGCACACCCTGTGAGGGGG - Intergenic
1059994146 9:119892875-119892897 CTGCTGCATGCCCAGAGAGGTGG - Intergenic
1185769722 X:2756707-2756729 CTGTTGCACATCCTGTGAGGGGG - Intronic
1185942809 X:4340477-4340499 CCATTGCACACCCTGTGAGGGGG - Intergenic
1185982313 X:4793241-4793263 CCATCTCATGCCCTGTTAGGGGG + Intergenic
1185982827 X:4798607-4798629 CTGTTGCATGCCCTGCAAGGAGG - Intergenic
1186052996 X:5619299-5619321 CAGTTTCATGCTCTCTGAGGTGG + Intergenic
1186056409 X:5654350-5654372 CTGTCGCAAGTCCTGTGAGGGGG - Intergenic
1186185150 X:7013635-7013657 CTGTTGCACTTCCTGTGAGGTGG - Intergenic
1187097334 X:16162261-16162283 CTGTTGCATGCCCTGTGAGGGGG + Intergenic
1187144467 X:16625354-16625376 CTGTTGCACGTCCTGTGAGGGGG - Intronic
1187365244 X:18661271-18661293 CCCTTGCATGCCCTGAGATGGGG - Intronic
1188117510 X:26263500-26263522 CTGTCGCATGTCCTGCGAGGGGG - Intergenic
1188496330 X:30787090-30787112 CTGTTGCATGTCCTGCAAGGGGG - Intergenic
1189083892 X:38000418-38000440 CCATCACATGCCCTGTGAGGGGG - Intronic
1189401951 X:40678111-40678133 ACATTGCATGCCTTGTGTGGTGG - Intronic
1189642207 X:43085430-43085452 CCCTTGCAAGGCCTGTGATGGGG + Intergenic
1189833288 X:44996940-44996962 CCATCACATGCCCTGCGAGGGGG - Intronic
1189959006 X:46307198-46307220 CCATCACATGCCCTGTGAGGGGG - Intergenic
1190117296 X:47634604-47634626 CCCTTGCATGCCCAGTGATGTGG + Intergenic
1190483016 X:50896824-50896846 CTGTTGCATGTCCTGTGAGGGGG - Intergenic
1191006472 X:55715968-55715990 CTGTGGCATGCCCTGCAAGGGGG - Intergenic
1191766531 X:64704787-64704809 CCATTGCATGTCCTGCGAGGGGG - Intergenic
1191974845 X:66860951-66860973 CCGTTGTAAGCCCTGCAAGGGGG - Intergenic
1192001271 X:67154605-67154627 CTGTTGGATGCTCTGAGAGGGGG - Intergenic
1192098453 X:68238698-68238720 CAGTCTCATGCCCTGTGAAGGGG - Intronic
1193400427 X:81036271-81036293 CCATCGCATGCCCTGTGAGGGGG - Intergenic
1193608238 X:83594500-83594522 CCACTGCACGCCCTGTGAGAGGG + Intergenic
1193846482 X:86478656-86478678 CTGTCACATGCCCTGTGAGGGGG - Intronic
1194298353 X:92155151-92155173 CCATCGCATGCCCTGCGAGAGGG + Intronic
1195265130 X:103172584-103172606 CTGTTGCACGCCCTCTGAGGGGG - Intergenic
1196072365 X:111539696-111539718 CCATCACATGCCCTGCGAGGGGG + Intergenic
1196281568 X:113828836-113828858 CCATTGCATGCCCTGGGAGCAGG + Intergenic
1196861626 X:120033982-120034004 CTGTTGCAGGCCCTGCAAGGGGG + Intergenic
1198271061 X:135056275-135056297 CCATTGCATGCCCTGCGAGGGGG + Intergenic
1199069842 X:143462997-143463019 CTGTCGCACACCCTGTGAGGGGG + Intergenic
1199874553 X:151920260-151920282 CCGGTCCAGGCTCTGTGAGGTGG + Intronic
1200164264 X:154025351-154025373 CCCCTGCCTGCCCTGTCAGGAGG - Intronic
1200558204 Y:4664481-4664503 CCATTGCACACCCTGTGTGGAGG + Intergenic
1200615961 Y:5380111-5380133 CCATCGCATGCCCTGCGAGAGGG + Intronic
1201725903 Y:17152132-17152154 CTGTTGCATGTCATGTGAGGGGG - Intergenic
1202020001 Y:20454150-20454172 CCATCACATGCCCTGTAAGGGGG + Intergenic