ID: 911434569

View in Genome Browser
Species Human (GRCh38)
Location 1:97840255-97840277
Sequence ATTAAGGGAGAGGGTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911434569_911434576 24 Left 911434569 1:97840255-97840277 CCCAGAACACCCTCTCCCTTAAT 0: 1
1: 0
2: 0
3: 16
4: 170
Right 911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911434569 Original CRISPR ATTAAGGGAGAGGGTGTTCT GGG (reversed) Intronic
900608995 1:3536545-3536567 AGTAGGGGAGGGGGTGTTGTGGG - Intronic
903486570 1:23693723-23693745 AGTCATGGAGATGGTGTTCTGGG + Intronic
903556277 1:24195928-24195950 GGAAAGGGAGAGGGGGTTCTTGG - Intergenic
904420827 1:30390088-30390110 TTTAGTGGAGAGGATGTTCTAGG - Intergenic
904909112 1:33920939-33920961 CTCAGGGGAGAGGGTGTTTTAGG + Intronic
904937888 1:34144728-34144750 AGTAAGGGAGGGGGTGTTGAGGG + Intronic
905481615 1:38265777-38265799 ATGTAGGGGGAGGGTGTTCCAGG - Intergenic
905817324 1:40961696-40961718 ATTAAGCCTGAGGGTGGTCTTGG + Intergenic
909833481 1:80223911-80223933 ATTTAGAGAGATGGTTTTCTAGG + Intergenic
910652214 1:89581900-89581922 ATTCAGTGACAGGTTGTTCTGGG + Intronic
910707636 1:90146688-90146710 AAGAAGGAAGAGGGTATTCTTGG + Intergenic
911434569 1:97840255-97840277 ATTAAGGGAGAGGGTGTTCTGGG - Intronic
911450235 1:98053297-98053319 ATTTGGGGAGAGGGTGTCGTGGG + Intergenic
912657388 1:111499285-111499307 AATAAGGATCAGGGTGTTCTGGG + Intronic
913303225 1:117395833-117395855 ATCAAGCCAGAGGGTGGTCTGGG - Intronic
913520487 1:119640985-119641007 CTTTAGGGAAAGGGTTTTCTAGG - Intronic
915899750 1:159837900-159837922 AATGAGGTAGAGGGTGTTCTGGG - Exonic
916790720 1:168122711-168122733 GTTAAGGGAAAGGGCATTCTGGG - Intronic
917231146 1:172839506-172839528 ATTAAGGCAGAGGCTTGTCTGGG + Intergenic
918501600 1:185201717-185201739 GTTAAGGGAGAGAGTGCTCTAGG - Intronic
920737030 1:208542171-208542193 ATCAAGGGAAAGGATATTCTAGG - Intergenic
921362779 1:214345360-214345382 AATAAGGGAGGAGGTGTTGTGGG - Intergenic
924573609 1:245259629-245259651 ATTAATGGACAGGGTGAGCTTGG + Intronic
924947352 1:248855530-248855552 ACTTAGGGAGATGGGGTTCTGGG - Intronic
1063362908 10:5471779-5471801 AATAAGGGATTGGGGGTTCTTGG - Intergenic
1065522051 10:26582649-26582671 ATTGGGGGACAGGGTGTTCTGGG - Intergenic
1065522828 10:26588808-26588830 ATTGGGGGACAGCGTGTTCTGGG - Intergenic
1065528193 10:26643419-26643441 ATTAAGGGACAGCTTGTTCCGGG - Intergenic
1069478760 10:68761232-68761254 ATTCATGTATAGGGTGTTCTTGG + Intronic
1070954745 10:80456238-80456260 ATTTAGGGAGACGGGGTTGTGGG + Intronic
1072525301 10:96266068-96266090 ATTAAAGGATAGCTTGTTCTAGG - Intronic
1073964526 10:108973530-108973552 ATAAATGGAAAGGGTGATCTAGG + Intergenic
1075592112 10:123699395-123699417 ATTAAATGAGATGGTGTTTTTGG - Intergenic
1075880196 10:125844494-125844516 AGAAAAGGAGAGGATGTTCTTGG + Intronic
1078491949 11:11777621-11777643 ATTAAGGGAAATGGCATTCTGGG + Intergenic
1080105714 11:28509781-28509803 GCTAAGGGAGAGTGTGTTATGGG + Intergenic
1081584184 11:44372854-44372876 AAAAAGGGAGAGGATGTTCTGGG - Intergenic
1081638088 11:44734219-44734241 ATAAAGGAAGAGGGTTTTTTTGG - Intronic
1083027032 11:59559718-59559740 ATTAAGAGAGAGCGTATTCAAGG - Intergenic
1084651971 11:70494816-70494838 ATGAAGGGAGAGAGTGCTGTGGG - Intronic
1084883124 11:72186258-72186280 AGTAAGGAAGAGGGTGTACTGGG - Intergenic
1085220611 11:74871040-74871062 TTTAATGGAGAGAGTGTACTGGG - Intronic
1085684030 11:78605589-78605611 ATGACGGGACAGGGTGGTCTTGG - Intergenic
1088440392 11:109864592-109864614 AATAAAAGAGAGGGTGATCTTGG - Intergenic
1089904890 11:122028457-122028479 ATCAAGATAGAGGGTTTTCTGGG - Intergenic
1090197261 11:124827303-124827325 ATTTGGGGAAAGGGTGTTCTGGG - Intergenic
1090912910 11:131136882-131136904 ATCAAGGGACTGGGTGTTCACGG + Intergenic
1091856550 12:3745352-3745374 ATTGAGGGAGGAGGAGTTCTTGG - Intronic
1091857914 12:3753801-3753823 ATGAAAGGGGAGGGTGTTCCAGG - Intronic
1095663766 12:44769974-44769996 ATTGAGGAAGAGAGTGGTCTTGG + Intronic
1098823018 12:75257090-75257112 ATTAAAGGAGGGGGAATTCTTGG + Intergenic
1099105292 12:78488523-78488545 ATGAAGGGAGAGAGAGTACTAGG - Intergenic
1099419130 12:82431389-82431411 ATTATGGGCTAGAGTGTTCTAGG - Intronic
1100257543 12:92899716-92899738 ATTAGGGGAGAGGGTGCAGTGGG + Intronic
1101514334 12:105420230-105420252 ATTCAGGGAGATGGTGGCCTTGG + Intergenic
1103010695 12:117456201-117456223 ATTAAGGGAGGGGCTGTCCTTGG - Exonic
1103160994 12:118729309-118729331 ATCTAGGGAGAGTGTCTTCTAGG - Intergenic
1103879762 12:124157223-124157245 ATCAAGGGAGTGGGGGTTATGGG + Intronic
1104496165 12:129241517-129241539 GGGGAGGGAGAGGGTGTTCTAGG - Intronic
1105949611 13:25217843-25217865 ATTCAAGGAAAGTGTGTTCTGGG + Intergenic
1105982225 13:25529533-25529555 TGTAAGGGAGAGGATGTCCTAGG + Intronic
1107477736 13:40755927-40755949 AATAAAGGAGAAGGTGTACTTGG - Intronic
1109189717 13:59309639-59309661 GTGAAGGGAGACTGTGTTCTAGG - Intergenic
1110947030 13:81435047-81435069 ATAAAGGGAGAGGGTGTTAAGGG - Intergenic
1111156812 13:84338283-84338305 ATGAAGGGCGAGGGTTGTCTTGG + Intergenic
1111496928 13:89062966-89062988 CTTAAAGGAAAGGGAGTTCTGGG - Intergenic
1112481232 13:99777320-99777342 ATTGAGGGAGAAGGTATTTTTGG - Intronic
1114911017 14:27196651-27196673 ATTGAGGGAGAGTATGTTCAGGG + Intergenic
1114975336 14:28089638-28089660 ATTAGGGGAGAAGGAGTTCATGG + Intergenic
1118593894 14:67421333-67421355 GTTCAAGGAGAGGCTGTTCTGGG - Intergenic
1121931010 14:97972159-97972181 ATTCAGGGGGTGGGTATTCTGGG + Intronic
1121962576 14:98275031-98275053 ATTAAGGGAGTGGGGCTGCTGGG - Intergenic
1122418841 14:101563082-101563104 CTTGAGGGGGAGGGTGCTCTGGG + Exonic
1126339389 15:47622633-47622655 AGTAAGGGAGAGGGGGTTGCAGG + Intronic
1127204384 15:56698141-56698163 TTTAATGGAACGGGTGTTCTGGG - Intronic
1131859372 15:96636322-96636344 ACACAGGGAGAGCGTGTTCTGGG + Intergenic
1133147589 16:3801372-3801394 ATTAAAGGACAGGGTGGGCTGGG + Intronic
1135505742 16:23034599-23034621 CTCAAGGGAAAGGATGTTCTAGG + Intergenic
1138732184 16:59207464-59207486 TTTAATGGAGAGGTTGTTATTGG + Intergenic
1144235417 17:13256125-13256147 ATTAAGGGATGGGGTGCTGTGGG + Intergenic
1148136876 17:45298970-45298992 GAAAAAGGAGAGGGTGTTCTGGG + Intronic
1148490293 17:48019118-48019140 AGTGAGTGACAGGGTGTTCTGGG - Intergenic
1150435389 17:65150261-65150283 AGCATGGGTGAGGGTGTTCTAGG - Intronic
1151263013 17:72931493-72931515 ATGAACGGAGAGCGGGTTCTGGG - Intronic
1152506752 17:80754426-80754448 AGGTAAGGAGAGGGTGTTCTTGG - Intronic
1155499062 18:26469070-26469092 ATTACAGTACAGGGTGTTCTGGG - Intronic
1156644594 18:39145880-39145902 AAAAAGGGAGAGGGTATACTAGG + Intergenic
1159755737 18:72361514-72361536 ATCTAGGGAGAGGTTGTTCCAGG - Intergenic
1160576366 18:79856516-79856538 TTTCAGAGAGAGGGTCTTCTTGG + Intergenic
1164768901 19:30792893-30792915 AGTCAGGTAGAGGGTGCTCTAGG + Intergenic
1165039528 19:33059229-33059251 ATTCAGGGAGAAGGTGAGCTGGG - Intronic
1165123790 19:33580198-33580220 GTCAAGGGAGGGGGTTTTCTGGG - Intergenic
1168268551 19:55236928-55236950 ATTGAGGGAGAAGGTGATGTTGG + Exonic
1168573767 19:57491373-57491395 ATTAAGGAAGAGGGTGAGCAGGG + Intronic
1168575375 19:57504562-57504584 ATTAAGGAAGAGGGTGAGCAGGG + Intronic
925852378 2:8094933-8094955 ATTAGAGGGGAGGGTGTTATAGG + Intergenic
926787423 2:16531789-16531811 ATTATGGGAGAGGGACTCCTTGG + Intergenic
926948182 2:18211870-18211892 AGTAAGGGAGAAAGTGTTTTAGG - Intronic
928456742 2:31429173-31429195 ATTAGGGGAAAGGGAGTTCTAGG - Intergenic
930570148 2:53076330-53076352 ATTAAGGATGAGGATGGTCTTGG - Intergenic
931023368 2:58077271-58077293 ATGAACTGATAGGGTGTTCTAGG - Intronic
932197962 2:69800684-69800706 ATTAAGGGACAAGGTGTTTCAGG + Intronic
933367611 2:81373819-81373841 ACTCAGGGAGAGTGTGTTCATGG - Intergenic
933594916 2:84273803-84273825 ATTACGGGACAGAGAGTTCTAGG - Intergenic
933797411 2:85930642-85930664 ATGAAGGGTGAGTGTGTTGTTGG - Intergenic
935824557 2:106931715-106931737 AGTGAGGGAGAGGATGTTCTTGG - Intergenic
935949254 2:108314026-108314048 ATGTGGGGAGAGGGTGTGCTAGG - Intergenic
941364870 2:164598054-164598076 ATGAAGGGAGAGAAGGTTCTAGG - Intronic
942688514 2:178560204-178560226 ATTAAGGGAGAGGTTTCACTTGG + Exonic
943373316 2:187044156-187044178 ATTGGGGGATAGGGTGTTCTAGG + Intergenic
945032383 2:205678023-205678045 TTTAAGGGAGAGGGTTGACTGGG + Intergenic
945966769 2:216195998-216196020 ACTAAGGGAGAGCTTGGTCTGGG + Intronic
946537536 2:220647642-220647664 GTTCAGGGGGAGGGTTTTCTAGG + Intergenic
947214137 2:227734975-227734997 AGTAATGGAGAGGGTGTTGTTGG + Intergenic
948318355 2:237047816-237047838 ACTAAGAGAGAGGGTGTTATGGG + Intergenic
1170108388 20:12777976-12777998 AGAAAGTGAGAGGGTGCTCTGGG + Intergenic
1170289436 20:14751876-14751898 ATTATGGTAGATGATGTTCTTGG - Intronic
1170347182 20:15400303-15400325 ACTAAGGAAGAGGGTGTCCTGGG - Intronic
1171725865 20:28620521-28620543 ATTGGGGGACAGGATGTTCTGGG - Intergenic
1172318820 20:33979973-33979995 CTTCAGAGAGAGGGTGTCCTGGG - Intergenic
1172607440 20:36223479-36223501 ATTAGGGGAGGGGTTCTTCTGGG + Intronic
1172998893 20:39091525-39091547 AGGCAGGGAGAGGGTGGTCTGGG + Intergenic
1173861884 20:46289163-46289185 ATCAGGGGCGAGGGTGTTCCAGG - Intronic
1174182779 20:48685282-48685304 ATTAATGTGGAGGGTGTCCTGGG - Intronic
1174726226 20:52865097-52865119 ATGAATAGAAAGGGTGTTCTGGG - Intergenic
1174892148 20:54407090-54407112 ATGAAGGGAGAGGGATTACTTGG + Intergenic
1175454699 20:59103360-59103382 GGTAAGGAAGAGAGTGTTCTGGG + Intergenic
1175554476 20:59838809-59838831 TATAATGCAGAGGGTGTTCTGGG + Intronic
1178795934 21:35744378-35744400 AGGAAGGGAGGGGGTGTTCCAGG - Intronic
1179305532 21:40150771-40150793 ACAAAGGGAGATGGTTTTCTGGG + Intronic
1181447023 22:22984968-22984990 ATTAAGTGAGAGGGCATTCAGGG + Intergenic
1182743577 22:32587389-32587411 GTTCAGGGGGAGGGAGTTCTGGG - Intronic
1183599787 22:38833213-38833235 AGTGAGGCAGAGGCTGTTCTGGG + Intronic
1184117515 22:42430974-42430996 ATTAAAGGAGATGGTGTCCTAGG + Intronic
1184546421 22:45172211-45172233 CTGAAGGGAGAGGATGTACTGGG - Intronic
949781823 3:7698221-7698243 AATATGGGAGATAGTGTTCTGGG + Intronic
951213976 3:20006419-20006441 ATGCATGGAGAGGGTGGTCTTGG - Intronic
954846796 3:53566443-53566465 ATTATGGGAGAGGGTGGTCAGGG - Intronic
955743983 3:62121684-62121706 AGTAGGGGAGAGGGTGGTGTAGG - Intronic
959394290 3:105817348-105817370 TTTAAGGGAGAGGAGATTCTAGG + Intronic
960922318 3:122759723-122759745 ATTTAGGGAAAGCGTGTTTTGGG + Intronic
961654590 3:128434049-128434071 ATAAAGAGAGAGGGTGCTCCTGG - Intergenic
961693704 3:128689107-128689129 GTTGGGGGAGAGGGTGGTCTTGG + Intergenic
966132030 3:176651950-176651972 ATCAAGGGACAGGGTGGTCATGG - Intergenic
970439926 4:16071875-16071897 AGTTAGGGACAGGGTGTTCCAGG - Intronic
970631350 4:17949495-17949517 GTTAAGGAAGAGGGGGTTATTGG - Intronic
971477323 4:27084534-27084556 ATTAAGGCAGAAGGGGATCTGGG - Intergenic
978106282 4:104905381-104905403 ATTCTGAGAGAGGGTCTTCTGGG + Intergenic
982469813 4:155774338-155774360 ATTTAGAGAGATTGTGTTCTGGG - Intronic
983428714 4:167620276-167620298 GTGAAGGGAGAGACTGTTCTCGG + Intergenic
985434691 4:189917274-189917296 ATTGGGGGACAGTGTGTTCTGGG + Intergenic
988232198 5:28493788-28493810 ATTTGGGGAGAGGGGGTTCCAGG + Intergenic
990991238 5:61686058-61686080 AAGAAGGAAGAGGGTGTCCTTGG - Intronic
992854936 5:80850023-80850045 ATTTAGGCAGAGGATGATCTGGG - Intronic
993132454 5:83915888-83915910 AATAAGCAAGAGGGTGGTCTTGG + Intergenic
1000203260 5:159032660-159032682 TTGAAGGGAGAGGGTGGTTTCGG - Intronic
1001247627 5:170116947-170116969 ATTTAGGGAGAGGGGAGTCTGGG - Intergenic
1001409799 5:171502699-171502721 CTTAAGAGAGAGTATGTTCTAGG - Intergenic
1003204684 6:3997051-3997073 ATGAAGGGAGAGACTGTTTTGGG - Intergenic
1003480276 6:6524978-6525000 TTTATGGGACAGGATGTTCTTGG - Intergenic
1005390163 6:25324812-25324834 AGTGAGGGAGAAGGTGTTCCAGG + Intronic
1006322727 6:33329827-33329849 AGTTAGGAAGAGAGTGTTCTGGG - Intergenic
1006625679 6:35396139-35396161 ATTGAGGGGTAGGGTGTCCTAGG - Intronic
1010113395 6:72270144-72270166 CTTAAGGGAAAGGAAGTTCTTGG + Intronic
1017456017 6:154602131-154602153 TTTGGGGGAGAGGGTGCTCTGGG + Intergenic
1033941547 7:146661144-146661166 ATCAAAGGAGAGTGTGTTTTTGG - Intronic
1034270735 7:149802433-149802455 ATTAAGGGAGATGGTGTGTGGGG + Intergenic
1034673683 7:152876430-152876452 TTTAAGGGAGAGAGTGTTAGGGG + Intergenic
1044195501 8:89372498-89372520 ATTAAGGGGGAGGGTCTTTGGGG - Intergenic
1044381965 8:91544736-91544758 ATTCTGGGAGATTGTGTTCTTGG - Intergenic
1045078685 8:98600205-98600227 ATTAAGGGAGAGGGTGCAGCTGG + Intronic
1047208784 8:122823951-122823973 ATTAAGTTAGACAGTGTTCTAGG - Intronic
1048332366 8:133479501-133479523 ACTAAGGGCAAGGGTGTCCTAGG - Intronic
1051152098 9:14093002-14093024 ATTATGGGAGTGTGTCTTCTAGG + Intronic
1051730166 9:20133062-20133084 ACTAAGGGAGAGATTATTCTGGG + Intergenic
1053620080 9:39806158-39806180 ATCAAGGGGGAGGATGATCTTGG + Intergenic
1053626618 9:39877784-39877806 ATCAAGGGGGAGGATGATCTTGG - Intergenic
1053894407 9:42728906-42728928 ATCAAGGGGGAGGATGATCTTGG - Intergenic
1054217269 9:62372919-62372941 ATCAAGGGGGAGGATGATCTTGG + Intergenic
1054264076 9:62901286-62901308 ATCAAGGGGGAGGATGATCTTGG - Intergenic
1057920103 9:99090346-99090368 ATTAAGGGTGAGGGGGTTGGGGG - Intergenic
1186114903 X:6294969-6294991 ATTAAGGCAGAGGGGTTGCTGGG - Intergenic
1186730109 X:12401117-12401139 ATTGAGGGAAAAAGTGTTCTAGG + Intronic
1190062920 X:47222548-47222570 ATTTAGGGGAAGGGTGTTCCAGG + Intronic
1192038925 X:67596320-67596342 TATCAGGGAGAGGGTCTTCTTGG + Intronic
1196284891 X:113868020-113868042 ATTTTTGGAGAGGGTGTACTTGG - Intergenic
1197984221 X:132250257-132250279 AATTAGAGAAAGGGTGTTCTGGG - Intergenic