ID: 911434570

View in Genome Browser
Species Human (GRCh38)
Location 1:97840256-97840278
Sequence GATTAAGGGAGAGGGTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911434570_911434576 23 Left 911434570 1:97840256-97840278 CCAGAACACCCTCTCCCTTAATC 0: 1
1: 0
2: 0
3: 20
4: 167
Right 911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911434570 Original CRISPR GATTAAGGGAGAGGGTGTTC TGG (reversed) Intronic
900608996 1:3536546-3536568 GAGTAGGGGAGGGGGTGTTGTGG - Intronic
901528667 1:9840223-9840245 CCTAAAGGGAGAGGGTGTTTGGG + Intergenic
904937887 1:34144727-34144749 AAGTAAGGGAGGGGGTGTTGAGG + Intronic
907305262 1:53509625-53509647 GAGTGAGGAAGAGTGTGTTCTGG - Intronic
907911481 1:58830988-58831010 GAATAAGAGAAAGGGTGTTAAGG + Intergenic
911434570 1:97840256-97840278 GATTAAGGGAGAGGGTGTTCTGG - Intronic
911450234 1:98053296-98053318 GATTTGGGGAGAGGGTGTCGTGG + Intergenic
912657387 1:111499284-111499306 GAATAAGGATCAGGGTGTTCTGG + Intronic
914246584 1:145890621-145890643 GATTAAGGGAGAAAGTATACTGG - Intergenic
915899751 1:159837901-159837923 CAATGAGGTAGAGGGTGTTCTGG - Exonic
915936172 1:160091533-160091555 GACAGAGGGAGAGGGTGTCCAGG + Exonic
916291071 1:163166758-163166780 GATTCAGAGAGAAGCTGTTCTGG - Intronic
916805919 1:168261135-168261157 TATTAAGGGAGAAGGTATCCAGG - Intergenic
916912769 1:169368426-169368448 GATTTAGGGAAAGATTGTTCCGG + Intronic
918160590 1:181895246-181895268 GATAAAGGGAGAAGGTGTTATGG - Intergenic
918624005 1:186637191-186637213 AATTAAGGGAGAGGATGGTGGGG + Intergenic
921489984 1:215763446-215763468 GATGTAGGGAAAGGGAGTTCAGG + Intronic
921503028 1:215929919-215929941 GATAAGTGGAGAGGGGGTTCAGG + Intronic
922192070 1:223328239-223328261 GATTAAGTGAGATGCTGTACTGG - Intronic
924947353 1:248855531-248855553 GACTTAGGGAGATGGGGTTCTGG - Intronic
1063688015 10:8257055-8257077 GATTAGGTGAGAGGGTGGCCAGG + Intergenic
1064582742 10:16810589-16810611 GAATAAGGCAGTGGGTGTGCTGG + Intronic
1064672999 10:17734732-17734754 GCTTCAGGGAGAGGAAGTTCAGG + Intergenic
1065522052 10:26582650-26582672 CATTGGGGGACAGGGTGTTCTGG - Intergenic
1065528194 10:26643420-26643442 CATTAAGGGACAGCTTGTTCCGG - Intergenic
1065559034 10:26944112-26944134 TATCAAGGGACAGGGTGTTCCGG + Intergenic
1067736180 10:48852733-48852755 GAGGACGGGAGAGGCTGTTCAGG - Intronic
1071878623 10:89870016-89870038 GATTGAGGGTGAGTGTGTGCAGG + Intergenic
1075032425 10:119032856-119032878 GAGTAGTGGAGAGGGTCTTCTGG - Exonic
1075154640 10:119964436-119964458 GATTAAGAGAGAGTGTGTGCTGG + Intergenic
1075504333 10:123008916-123008938 GATTAAGGGGGGGTGTGTGCGGG + Intergenic
1076012114 10:126997479-126997501 GAGGAAGAGAGAGGGTGTGCGGG + Intronic
1076229316 10:128807208-128807230 GGTTAAGGGAGGGTGTGCTCGGG - Intergenic
1077287243 11:1773067-1773089 GTTTGGGGGAGAGGGTGTCCAGG + Intergenic
1077840346 11:5967783-5967805 GATTAAGGGTGAGGGAGATATGG - Exonic
1078118339 11:8479485-8479507 GAATCAGGGAGAGGGTTTCCTGG - Intronic
1081584185 11:44372855-44372877 AAAAAAGGGAGAGGATGTTCTGG - Intergenic
1084883125 11:72186259-72186281 CAGTAAGGAAGAGGGTGTACTGG - Intergenic
1086592795 11:88535294-88535316 GATCATGGGAGAGAGTCTTCTGG + Intronic
1086604320 11:88677585-88677607 GCTTAAGGTATAGGGTGATCAGG - Intronic
1086809672 11:91292813-91292835 GATTTAGAGAGAGGGTCTACTGG - Intergenic
1087785834 11:102353259-102353281 GATTAAGGGAGAAGATGTAGGGG + Intronic
1087944555 11:104142711-104142733 GAACAAGGGAGAGGGTTTCCAGG + Intronic
1089154380 11:116389577-116389599 GAGAAAGGGAGAGGATTTTCTGG + Intergenic
1090197262 11:124827304-124827326 TATTTGGGGAAAGGGTGTTCTGG - Intergenic
1091042236 11:132292463-132292485 GATGGAGGGAGAGGGTGGTGAGG + Intronic
1092092385 12:5813535-5813557 GATTATGGGCGACGGTGGTCAGG - Intronic
1093919908 12:24848288-24848310 GAAAAACTGAGAGGGTGTTCGGG - Intronic
1101762793 12:107672809-107672831 TATTAAGAGACAGGGTGTTTGGG + Intergenic
1103879761 12:124157222-124157244 GATCAAGGGAGTGGGGGTTATGG + Intronic
1105646396 13:22322515-22322537 GATTATTGGAGAGTGTGTTGAGG - Intergenic
1106517673 13:30469241-30469263 GAGCATGGGAGAGGGTGTTCAGG - Intronic
1106950687 13:34880415-34880437 GATGAATGGAGCAGGTGTTCAGG + Intergenic
1107230993 13:38110339-38110361 GGTTAAGGGAGTATGTGTTCAGG - Intergenic
1108640344 13:52377787-52377809 GATTTAGGGAGAGGGTTTAATGG + Exonic
1110947031 13:81435048-81435070 AATAAAGGGAGAGGGTGTTAAGG - Intergenic
1111403718 13:87774006-87774028 TGTTATGGGAGAGAGTGTTCTGG + Intergenic
1111496929 13:89062967-89062989 GCTTAAAGGAAAGGGAGTTCTGG - Intergenic
1114215139 14:20652392-20652414 GATTAAGTTAGAGGCTGTTAGGG - Intergenic
1114911016 14:27196650-27196672 CATTGAGGGAGAGTATGTTCAGG + Intergenic
1115426973 14:33271374-33271396 GCTTCAGGGAAAGGGGGTTCTGG + Intronic
1120075399 14:80151319-80151341 GGTTAAGGTAGAGGGTGTTTTGG - Intergenic
1120247721 14:82026218-82026240 GACTAAGTGAGAGGGCGTTTTGG - Intergenic
1121312565 14:92943156-92943178 GATTAGGCGAGAGGATGTTGCGG - Intronic
1121931009 14:97972158-97972180 GATTCAGGGGGTGGGTATTCTGG + Intronic
1123111054 14:105866988-105867010 GAGTGAGGAAGAGGGTGGTCTGG + Intergenic
1126695111 15:51319170-51319192 GATTAAGGGAAAGGGTGTAGGGG - Intronic
1127670224 15:61187927-61187949 GGTTGAGGGAGAGGATGTTGGGG - Intronic
1130149178 15:81298394-81298416 GGGTAAGGGAGAGGGTGTCCTGG - Intronic
1131117305 15:89803259-89803281 GGTTCAGGTAGATGGTGTTCTGG + Exonic
1132279094 15:100596992-100597014 GATGAAAGGAGAGGGTTTCCAGG - Intronic
1132285927 15:100662283-100662305 ATGTAAGGGAGAGGGGGTTCAGG + Intergenic
1134859472 16:17548296-17548318 GACTCAGGGAAAGGGTGTTGGGG - Intergenic
1137441878 16:48504907-48504929 GAGTCAGGGAGAGGCTGTTACGG + Intergenic
1138572545 16:57884906-57884928 GATGAAGGGAGAGGCTGCTGGGG + Intronic
1140256053 16:73337280-73337302 GGTTCAGGGAGAGGGAGTTTTGG - Intergenic
1143854806 17:9840772-9840794 GTTTTAGAGGGAGGGTGTTCAGG + Intronic
1145976691 17:28988018-28988040 GATGATGGGGAAGGGTGTTCTGG + Intronic
1146327723 17:31901519-31901541 GATTAAGTGAGAGAGGGTTGGGG - Exonic
1149177769 17:53894791-53894813 GATTAAGCGAAATGGTGTGCAGG + Intergenic
1151263014 17:72931494-72931516 GATGAACGGAGAGCGGGTTCTGG - Intronic
1152803471 17:82343013-82343035 GATCAAGGGTGAGGGGGTGCTGG + Intergenic
1157053478 18:44197878-44197900 GATTAGGGGAGAGGGAGCACTGG - Intergenic
1157713453 18:49865886-49865908 GGTTAGGGGAGATGGTGTCCAGG - Intronic
1158381528 18:56935618-56935640 GATTAGGAGTCAGGGTGTTCTGG - Intronic
1159154587 18:64566878-64566900 GATTACTGGAGGGGATGTTCAGG + Intergenic
1160266463 18:77343429-77343451 GTATTAGGGAGAGGGTGTTGGGG + Intergenic
1162277190 19:9665306-9665328 GATTAAGGAGAAGGGTGTTGTGG - Intronic
1163312332 19:16521935-16521957 GAATAAACCAGAGGGTGTTCAGG - Intronic
1165039529 19:33059230-33059252 GATTCAGGGAGAAGGTGAGCTGG - Intronic
1165949561 19:39466500-39466522 TCTTCAGGGAGATGGTGTTCTGG - Exonic
1167160891 19:47766441-47766463 GTTTAAGGTAGAGGGTGAGCAGG + Intergenic
1168573766 19:57491372-57491394 GATTAAGGAAGAGGGTGAGCAGG + Intronic
1168575374 19:57504561-57504583 GATTAAGGAAGAGGGTGAGCAGG + Intronic
926935940 2:18086685-18086707 GGTAAAGGGGGAGGGAGTTCAGG - Intronic
927868188 2:26606434-26606456 GATTCAGGGAAAAGCTGTTCAGG + Intronic
929052389 2:37849103-37849125 TAATAGGGAAGAGGGTGTTCTGG + Intergenic
929370120 2:41213058-41213080 CATTAATGGGCAGGGTGTTCTGG - Intergenic
937980221 2:127610241-127610263 CATTAACGGAGAGGGTGCCCTGG + Intronic
938657096 2:133445719-133445741 GAGTAAGGAAGGGGGAGTTCAGG + Intronic
938933811 2:136111349-136111371 TATTAAGAGATAGGGTCTTCGGG - Intergenic
939699479 2:145372333-145372355 GATTAGGGGAGAGGCTGATTGGG + Intergenic
945036255 2:205706502-205706524 GATAATGGGAGAGGGGGGTCGGG - Intronic
945451646 2:210001790-210001812 GCTTCAGGGAAAGGGGGTTCCGG + Intergenic
945784119 2:214212397-214212419 GATGCAGGGAGTGGGTGGTCGGG - Intronic
946012945 2:216581066-216581088 GATGGAGGGTGAGGGTGTGCAGG + Intergenic
948318354 2:237047815-237047837 AACTAAGAGAGAGGGTGTTATGG + Intergenic
948856358 2:240732268-240732290 GATGAAGGGAGAAGGGGATCAGG + Intronic
1170347183 20:15400304-15400326 CACTAAGGAAGAGGGTGTCCTGG - Intronic
1171322207 20:24256246-24256268 GATTCTGGGAGAGAATGTTCTGG - Intergenic
1172647415 20:36479618-36479640 CAGTGAGGAAGAGGGTGTTCAGG + Intronic
1172998892 20:39091524-39091546 GAGGCAGGGAGAGGGTGGTCTGG + Intergenic
1175554475 20:59838808-59838830 GTATAATGCAGAGGGTGTTCTGG + Intronic
1177667107 21:24174604-24174626 TATCAAAGGAGAGGGTGTCCTGG - Intergenic
1181447022 22:22984967-22984989 GATTAAGTGAGAGGGCATTCAGG + Intergenic
1181785738 22:25225311-25225333 GATGAAGGGAGAGGGTCATGTGG + Intronic
1183398520 22:37587316-37587338 GAGTCAGGGAGAGGGAGCTCAGG + Intergenic
1185239519 22:49735173-49735195 GCTTCAGGGAGGGGGTGGTCGGG + Intergenic
951316812 3:21197042-21197064 GATCAAGTGAGGGGGTGTTTGGG + Intergenic
951776099 3:26311924-26311946 GATTACGGGACAGGTAGTTCAGG + Intergenic
953534588 3:43767936-43767958 GAGTAAATGAGAGGGTGTTCAGG - Intergenic
954846797 3:53566444-53566466 TATTATGGGAGAGGGTGGTCAGG - Intronic
956095756 3:65714285-65714307 GGTCCAGGCAGAGGGTGTTCAGG - Intronic
958750421 3:98188363-98188385 GTTTAAGGGAGGGGGTGTGCTGG + Intronic
960580650 3:119275809-119275831 TAATAGGGGAGAGGGTTTTCAGG - Intergenic
962385606 3:134929992-134930014 GTTTAAGGCAGAGATTGTTCTGG + Intronic
964621135 3:158721123-158721145 GAGAGAGGGAGAGGGTGCTCTGG + Intronic
966639714 3:182176262-182176284 GATTGTGGTAGATGGTGTTCTGG + Intergenic
966667288 3:182486239-182486261 TACTCAGGGAGATGGTGTTCAGG + Intergenic
967186742 3:186950398-186950420 GACTGGGGGAGAGGGTGTTGAGG + Intronic
967985897 3:195095129-195095151 GAGTCAGGGAAAGTGTGTTCTGG + Intronic
968782181 4:2591392-2591414 GTTTAAGGCAGAGAATGTTCTGG + Intronic
969040747 4:4293909-4293931 GATTAAGGCAGAGCCTGTGCAGG + Intronic
969879615 4:10162289-10162311 GTTTAAGGGAGAGGGTCCACTGG - Intergenic
970551212 4:17182989-17183011 GATTAAGCGAAAGGGGGTTGGGG - Intergenic
973002580 4:44969587-44969609 GGATAAGGGAGATGGTGTACGGG - Intergenic
974627763 4:64445781-64445803 GATTAATGGAAAGAATGTTCAGG + Intergenic
977407218 4:96615302-96615324 GATTATGGGAGAGAGTTTTATGG + Intergenic
982539381 4:156648867-156648889 GATTAAGAAAGAGGGTGCTTTGG - Intergenic
985117576 4:186606678-186606700 AATTGAGGGGGAGGGTGATCTGG - Intronic
987380716 5:17283307-17283329 GATTAAGAGAGACCATGTTCAGG + Intergenic
992825396 5:80544958-80544980 GAATAAGGGAGAATGTTTTCAGG + Intergenic
992854937 5:80850024-80850046 GATTTAGGCAGAGGATGATCTGG - Intronic
997633781 5:135389868-135389890 GATTAGAGGAGAGGGGGCTCTGG - Intronic
998117569 5:139549613-139549635 GGTGTAGGGGGAGGGTGTTCAGG - Intronic
998256318 5:140591486-140591508 GATTAAGGAAGAGGGTGGGAGGG + Intronic
999422968 5:151460703-151460725 GATTAAGGTAGAGGTTGATTTGG + Intronic
1001679745 5:173547426-173547448 GAGGCAGGGAGAGGGCGTTCTGG + Intergenic
1001932693 5:175684374-175684396 GATTAAGGGAGCTGCTGTTTAGG + Intronic
1002816877 6:689307-689329 AATTAAGGTAAAGGATGTTCAGG + Intronic
1002856553 6:1043200-1043222 GATTCAGGAAGAGGGTGATCTGG + Intergenic
1013032834 6:106352365-106352387 GAATGAGAGAGAGGGTGTTGGGG - Intergenic
1015993929 6:138978794-138978816 GATTTAGTGGGAGGATGTTCTGG - Intronic
1016646135 6:146410681-146410703 GATTAAGAAAGAGGGGGTTAAGG + Intronic
1017456016 6:154602130-154602152 GTTTGGGGGAGAGGGTGCTCTGG + Intergenic
1021161640 7:17280497-17280519 CATTAAGAGAGAGGGAATTCAGG - Intergenic
1021690800 7:23229023-23229045 GAATCAGGGAGAGGGTGTGAAGG + Intergenic
1024180862 7:46893362-46893384 GATTAAGGGCCAGGCTGCTCAGG + Intergenic
1029536570 7:101160907-101160929 GTTAAAGGGAAAAGGTGTTCAGG + Exonic
1029956861 7:104649407-104649429 GAGTGGGGGAGAGGGTCTTCTGG + Intronic
1030707511 7:112709654-112709676 GATTTAGGGAGATGGTTTTCTGG - Intergenic
1030735019 7:113037757-113037779 GATCTAGGGAGAGAGTGTTAGGG + Intergenic
1034270734 7:149802432-149802454 GATTAAGGGAGATGGTGTGTGGG + Intergenic
1034673682 7:152876429-152876451 TTTTAAGGGAGAGAGTGTTAGGG + Intergenic
1035274625 7:157740404-157740426 GATGGAGGGAGACGATGTTCCGG - Intronic
1036681315 8:10876539-10876561 GCATAAGGGAGAGGGTGATGGGG - Intergenic
1037995582 8:23350073-23350095 GAAAAGGGGAGAGGGTGTTAGGG - Intronic
1041024830 8:53673260-53673282 GGTTAAGAGAGAGTGTGTTTAGG + Intergenic
1044195502 8:89372499-89372521 TATTAAGGGGGAGGGTCTTTGGG - Intergenic
1048344482 8:133566487-133566509 GATTAAGGGAGAGGATTCTTGGG - Intronic
1048497089 8:134944265-134944287 GATTAAGAGATGGGGTGTTTAGG - Intergenic
1049455957 8:142687901-142687923 GATTAAGAAAGAGCATGTTCAGG - Intergenic
1049976693 9:866813-866835 AATTGAGGGAGAGGGTGATAAGG - Intronic
1051210482 9:14737111-14737133 GGGTAAGGGTGAGGGTCTTCTGG + Exonic
1051778184 9:20658938-20658960 GATTAAGTGACAGGGTGTGGTGG + Intronic
1052986446 9:34491437-34491459 GATTAAGTGAGAAGGAGTTGAGG + Intronic
1056785860 9:89592120-89592142 GATGTAGGGAGAAGGTGTACAGG - Intergenic
1057258187 9:93567696-93567718 GAGGAAGGGAGAGGGTGCTGGGG + Intergenic
1057920104 9:99090347-99090369 CATTAAGGGTGAGGGGGTTGGGG - Intergenic
1060423960 9:123489265-123489287 GAGTAAGGGAGAGAGAGTTTAGG + Intronic
1062258506 9:135643938-135643960 GATTAATGGAAAGGATGTTCAGG + Intergenic
1185773100 X:2780791-2780813 GAAGCAGGGAGAGGGTTTTCAGG + Intronic
1186114904 X:6294970-6294992 GATTAAGGCAGAGGGGTTGCTGG - Intergenic
1186213347 X:7273376-7273398 GATTGAGGGAGAAGGGGTTCTGG - Intronic
1192467330 X:71366559-71366581 GAGGAAAGGAGAGGGTGCTCAGG + Intronic
1201362099 Y:13163626-13163648 GATTAAGGGAGTGGGTGTGAGGG + Intergenic
1201480229 Y:14430858-14430880 GATTCAGGGAGTAGGTGTGCAGG - Intergenic
1201586199 Y:15563892-15563914 GCTTTGGGGAGAAGGTGTTCTGG - Intergenic