ID: 911434572

View in Genome Browser
Species Human (GRCh38)
Location 1:97840265-97840287
Sequence TATTTCGTTGATTAAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911434572_911434579 29 Left 911434572 1:97840265-97840287 CCTCTCCCTTAATCAACGAAATA 0: 1
1: 0
2: 0
3: 8
4: 94
Right 911434579 1:97840317-97840339 TATTTTGGTTGAATCTGCTTTGG 0: 1
1: 0
2: 7
3: 88
4: 818
911434572_911434580 30 Left 911434572 1:97840265-97840287 CCTCTCCCTTAATCAACGAAATA 0: 1
1: 0
2: 0
3: 8
4: 94
Right 911434580 1:97840318-97840340 ATTTTGGTTGAATCTGCTTTGGG 0: 1
1: 0
2: 5
3: 187
4: 2054
911434572_911434576 14 Left 911434572 1:97840265-97840287 CCTCTCCCTTAATCAACGAAATA 0: 1
1: 0
2: 0
3: 8
4: 94
Right 911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911434572 Original CRISPR TATTTCGTTGATTAAGGGAG AGG (reversed) Intronic
902682234 1:18051511-18051533 TATTTGGTTGATTAAGAGGTTGG + Intergenic
911434572 1:97840265-97840287 TATTTCGTTGATTAAGGGAGAGG - Intronic
917329975 1:173870705-173870727 TATGTCGTGGGCTAAGGGAGCGG - Exonic
917441135 1:175070036-175070058 TGTTTGGTTGAATAAGGGAGAGG + Intronic
920714905 1:208330956-208330978 TATTTGGTTTATTAAGGCAGGGG + Intergenic
921578192 1:216862814-216862836 TATTACGTTGATTAAGGTATTGG + Intronic
924061857 1:240183321-240183343 TTATTCCTTGATTAAGTGAGGGG - Intronic
1068253946 10:54483377-54483399 TATTTATTTTATGAAGGGAGAGG + Intronic
1072786109 10:98283794-98283816 GATTTTCTTGAATAAGGGAGAGG + Intergenic
1073665631 10:105530431-105530453 TTTTTCCTTGTTTAATGGAGAGG + Intergenic
1074141627 10:110678612-110678634 AAGTTCATTGATCAAGGGAGTGG - Intronic
1074277587 10:112018896-112018918 TTTTTCTTTGATTCAGGTAGCGG - Intergenic
1075279180 10:121124939-121124961 CATTTCTTTGATTAATGGTGAGG - Intergenic
1078809176 11:14741071-14741093 TATTCCGTTGATTTGGGGTGGGG + Intronic
1085554576 11:77408669-77408691 AATTCCGTTGATTAACGAAGTGG + Intronic
1085896961 11:80651322-80651344 TCTTTCCTTGATAAAGGTAGAGG + Intergenic
1088088729 11:106012287-106012309 TGTTTGGTGGTTTAAGGGAGGGG - Intronic
1088322102 11:108564843-108564865 TATTTCTTTGATTACTAGAGAGG + Intronic
1089910510 11:122094984-122095006 TATTACCTTGATAAAGGAAGGGG + Intergenic
1091771968 12:3157985-3158007 TTTTTAGTAGATAAAGGGAGGGG - Intronic
1092459924 12:8677395-8677417 GATTTTGGTGATTAAGGGTGTGG - Intergenic
1092654637 12:10672210-10672232 CATTTCGTTGTTTAAGCCAGAGG + Intronic
1097266170 12:57746027-57746049 TGTTTCGTAGATTATGGGACAGG - Intronic
1098075343 12:66723893-66723915 TATTTCTTTGATTAGGTCAGTGG + Intronic
1100412129 12:94330350-94330372 TATGGTGGTGATTAAGGGAGGGG - Intronic
1101774278 12:107779459-107779481 TATTGCCATAATTAAGGGAGAGG + Intergenic
1103362114 12:120360605-120360627 TTTTTCATTGGTTAAGTGAGGGG - Intronic
1106068233 13:26379904-26379926 TACTTCTGTCATTAAGGGAGAGG + Intronic
1107979390 13:45719980-45720002 TGATTGGTTGATTAAAGGAGAGG - Intergenic
1108411335 13:50150398-50150420 TATTTCAGTGAGTAAGGGTGAGG + Intronic
1113201490 13:107871153-107871175 TATTTACTTGATTTATGGAGTGG - Intergenic
1116755728 14:48945678-48945700 TATTTGGTTGATTAGGGGGCTGG + Intergenic
1127746570 15:61982058-61982080 TATTTCCTTGGTTAAGGAACTGG + Intronic
1130088450 15:80798591-80798613 TATTTCTTTGATAACTGGAGAGG + Intronic
1135645857 16:24161421-24161443 TATTGATTTGATTTAGGGAGGGG + Intronic
1138403570 16:56769353-56769375 AATAACGTTGATTGAGGGAGAGG + Intronic
1142548441 17:722031-722053 TACTTCCTTGAGTAAGGGAAAGG - Intergenic
1142931509 17:3288571-3288593 AATTTCTTTGATTATGGGTGTGG - Intergenic
1143831022 17:9651089-9651111 TATTTCTTTGATTAGGAGCGAGG + Intronic
1147520593 17:41168584-41168606 TATTCCATTGACCAAGGGAGAGG + Intergenic
1149777929 17:59372606-59372628 TATTTCCTTACTGAAGGGAGCGG - Intronic
1155362653 18:25017483-25017505 AATTATGTTGCTTAAGGGAGGGG + Intergenic
1165533871 19:36426716-36426738 TATTTCTTTTTTTAGGGGAGTGG - Intergenic
1166652067 19:44582267-44582289 TTCTTCGTTAACTAAGGGAGGGG - Intergenic
1167211631 19:48137274-48137296 TACTTCCTGGATAAAGGGAGAGG - Intronic
925726930 2:6882140-6882162 AATTTCTGTGATGAAGGGAGGGG - Intronic
925845913 2:8033182-8033204 TATTTCTTTAATTAAAAGAGAGG - Intergenic
925966795 2:9073971-9073993 GATTTAGTTGAACAAGGGAGGGG + Intergenic
932129191 2:69172173-69172195 TATTTAATTGATTAAGTCAGAGG - Intronic
932129385 2:69174051-69174073 TATTTAGTTGATTAAGCCAGAGG - Intronic
934577136 2:95410037-95410059 TATTTTATGGATTATGGGAGAGG + Intronic
934639439 2:96018703-96018725 TATTTTATGGATTATGGGAGAGG + Intergenic
934794214 2:97086682-97086704 TATTTTATGGATTATGGGAGAGG - Intronic
935298787 2:101674587-101674609 TATTTCTTTAATGGAGGGAGAGG + Intergenic
935557469 2:104526078-104526100 TATTTTGTTCACAAAGGGAGAGG + Intergenic
939433581 2:142143741-142143763 TATTTCCTTGATTAAAAAAGAGG + Intergenic
940127252 2:150340437-150340459 TATTTGGTTAATTCAGGCAGTGG + Intergenic
943499485 2:188669224-188669246 TAATTCTCTGATTCAGGGAGTGG + Intergenic
946910803 2:224458760-224458782 TATTTCGTTGTTTTAGAGATGGG + Intergenic
1177087339 21:16722850-16722872 TATTTTGATGATTATGGGATTGG + Intergenic
1179373261 21:40826430-40826452 TATTTTGGGGATGAAGGGAGAGG + Intronic
956533588 3:70250098-70250120 TATTTAGTTGTTTAAGCCAGGGG + Intergenic
965699428 3:171444523-171444545 CATCTTGTTGATCAAGGGAGTGG + Intronic
967000860 3:185333012-185333034 TATTTCTTTCATTATGAGAGGGG + Intronic
970320045 4:14866588-14866610 TATATATTTTATTAAGGGAGGGG + Intergenic
970830962 4:20339255-20339277 TTTTTCTTTGGATAAGGGAGTGG + Intronic
975849562 4:78557720-78557742 TAGTTCTTTAATTGAGGGAGAGG - Intronic
977853358 4:101857522-101857544 TCTATCGTTAATTAAGGCAGTGG + Intronic
977874592 4:102133746-102133768 TTCTTCTTAGATTAAGGGAGTGG - Intergenic
981333430 4:143539249-143539271 TAATTCTTTGATCAAGGGGGTGG - Intronic
982312853 4:154003849-154003871 TATCTCTTTGATAAATGGAGAGG - Intergenic
993226839 5:85177198-85177220 AATTTCCTTGATTAAGAGATAGG - Intergenic
995359705 5:111281440-111281462 TATACCATAGATTAAGGGAGAGG - Intronic
998670988 5:144353328-144353350 TATTTCTCTGATCAAGGGAGTGG + Intronic
1002435107 5:179226600-179226622 TGTTTCTTTAATTAAGGGTGAGG - Intronic
1006573625 6:35026509-35026531 TATGTAGTTGATGATGGGAGTGG + Intronic
1008826323 6:55698304-55698326 TATTTCCTTGAAGAAAGGAGAGG + Intergenic
1009731629 6:67615309-67615331 TATTACGTTGAATAGGAGAGTGG - Intergenic
1010255835 6:73757131-73757153 TATTTTGTTGGTGAATGGAGAGG + Intronic
1014287229 6:119514201-119514223 TTTTTCATTGTTTTAGGGAGAGG + Intergenic
1015053975 6:128876729-128876751 TATTTCCTTGATTATGGCATTGG - Intergenic
1021250219 7:18316149-18316171 TATTTAGTTGATCTAGGGTGAGG + Intronic
1021357994 7:19677678-19677700 TGTTTCCTTGTTTAAGAGAGAGG - Intergenic
1022312980 7:29214743-29214765 TATTTGGGTGATTAAGTAAGAGG - Intronic
1033337266 7:140464399-140464421 TATTTTGTTTTTTAAGGGACAGG - Intronic
1038601563 8:28948833-28948855 TATTTCCTTTATTAAGGGTTGGG + Intronic
1041204426 8:55483752-55483774 TTTTTTTTTGTTTAAGGGAGAGG - Intronic
1043108391 8:76146029-76146051 TACTTGGTTTATTAGGGGAGTGG + Intergenic
1047685440 8:127300647-127300669 TATTTATTTGATTAGGGTAGAGG - Intergenic
1051478874 9:17538459-17538481 TATTTGGTAGATTTAGGGAGTGG + Intergenic
1051775879 9:20633644-20633666 TATTTATTTGTTTAAGGTAGTGG + Intergenic
1058269708 9:102955473-102955495 TAGTTCGTTTATTTAGGGTGAGG + Intergenic
1059844044 9:118251185-118251207 TATTTGGTTGAGGAAGGGAGTGG + Intergenic
1059994727 9:119897587-119897609 AAGTTTGTTGATTAAGGGAGAGG - Intergenic
1060742691 9:126110050-126110072 TGTTGCGGTGACTAAGGGAGAGG + Intergenic
1187346320 X:18467792-18467814 TATTTTGGGAATTAAGGGAGTGG + Intronic
1188893630 X:35640237-35640259 TATTTCGTTGCCTAAGGAAATGG + Intergenic
1189679943 X:43505464-43505486 TATTTCTTGGATTAATGGTGTGG + Intergenic
1198810345 X:140529894-140529916 TATTTCTTTTCTTAAGGAAGTGG + Intergenic
1199289206 X:146087607-146087629 TATTTAGTTAATGCAGGGAGGGG + Intergenic
1199579491 X:149347135-149347157 TATTTAGTTGAGAAAGGGACTGG - Intergenic
1201561254 Y:15319770-15319792 TATTCTGTTGATTTAGGGTGGGG + Intergenic
1201953881 Y:19599293-19599315 TATTTGGGAGACTAAGGGAGGGG - Intergenic