ID: 911434574

View in Genome Browser
Species Human (GRCh38)
Location 1:97840270-97840292
Sequence ACTCCTATTTCGTTGATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911434574_911434579 24 Left 911434574 1:97840270-97840292 CCCTTAATCAACGAAATAGGAGT No data
Right 911434579 1:97840317-97840339 TATTTTGGTTGAATCTGCTTTGG 0: 1
1: 0
2: 7
3: 88
4: 818
911434574_911434580 25 Left 911434574 1:97840270-97840292 CCCTTAATCAACGAAATAGGAGT No data
Right 911434580 1:97840318-97840340 ATTTTGGTTGAATCTGCTTTGGG 0: 1
1: 0
2: 5
3: 187
4: 2054
911434574_911434576 9 Left 911434574 1:97840270-97840292 CCCTTAATCAACGAAATAGGAGT No data
Right 911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911434574 Original CRISPR ACTCCTATTTCGTTGATTAA GGG (reversed) Intronic
No off target data available for this crispr