ID: 911434575

View in Genome Browser
Species Human (GRCh38)
Location 1:97840271-97840293
Sequence TACTCCTATTTCGTTGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911434575_911434580 24 Left 911434575 1:97840271-97840293 CCTTAATCAACGAAATAGGAGTA 0: 1
1: 0
2: 0
3: 4
4: 67
Right 911434580 1:97840318-97840340 ATTTTGGTTGAATCTGCTTTGGG 0: 1
1: 0
2: 5
3: 187
4: 2054
911434575_911434576 8 Left 911434575 1:97840271-97840293 CCTTAATCAACGAAATAGGAGTA 0: 1
1: 0
2: 0
3: 4
4: 67
Right 911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG No data
911434575_911434579 23 Left 911434575 1:97840271-97840293 CCTTAATCAACGAAATAGGAGTA 0: 1
1: 0
2: 0
3: 4
4: 67
Right 911434579 1:97840317-97840339 TATTTTGGTTGAATCTGCTTTGG 0: 1
1: 0
2: 7
3: 88
4: 818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911434575 Original CRISPR TACTCCTATTTCGTTGATTA AGG (reversed) Intronic
908975862 1:69897541-69897563 TACTCCTATCTCATAGAATAAGG + Intronic
910486861 1:87724210-87724232 TTCTCCTATATCGTTGATTCTGG - Intergenic
910814372 1:91274907-91274929 TTCTCCTAATTCATTGATTTGGG - Intronic
911434575 1:97840271-97840293 TACTCCTATTTCGTTGATTAAGG - Intronic
915909381 1:159903467-159903489 TACTCCTATTCCATTGACGATGG - Intergenic
919512225 1:198479484-198479506 TATTCTTATTTTGTAGATTAGGG - Intergenic
920972841 1:210757312-210757334 TACTCCTATGTCCCTTATTATGG - Intronic
1064667608 10:17672734-17672756 TACTCCATTTTCTTTGATTAGGG - Intronic
1067568595 10:47355416-47355438 TGCTCCTACTTCTTTGATGAAGG + Exonic
1070472575 10:76797834-76797856 TATTTCTTTTTCCTTGATTACGG + Intergenic
1071665332 10:87550082-87550104 TATTCCTGTTTAGCTGATTATGG + Intronic
1071739724 10:88343522-88343544 TACTCCTTTTTTGTTGTTTTTGG - Intronic
1074594593 10:114850073-114850095 TATTCCTTTTTTGTTGAATACGG + Intronic
1080304316 11:30820095-30820117 TACTTCTATTAAGTTAATTATGG - Intergenic
1089099309 11:115947897-115947919 TTCTGCTCTTTCTTTGATTATGG - Intergenic
1089205611 11:116759701-116759723 TATTCCAATTTCGTTGCTGAAGG - Intronic
1093901628 12:24641588-24641610 TACACCTATTATCTTGATTATGG + Intergenic
1097519569 12:60649619-60649641 TATCCCTATTTCGTTGATATAGG - Intergenic
1097959960 12:65522644-65522666 TATTCCTCTCTCTTTGATTATGG - Intergenic
1097982516 12:65748997-65749019 TACTTATTTTTCTTTGATTATGG - Intergenic
1098929853 12:76398725-76398747 TACGCCTATTTGGGGGATTAAGG - Intronic
1109511449 13:63379910-63379932 TATTCCTATTTCATTCATTTGGG + Intergenic
1109981813 13:69918394-69918416 TACTCATATTTCATTTAATATGG + Intronic
1113296572 13:108965335-108965357 TTCACTTATTTCGTGGATTATGG + Intronic
1114893349 14:26953557-26953579 TACTAGTATTAAGTTGATTATGG - Intergenic
1116673166 14:47870248-47870270 TACTCTTTTTTAGTTGTTTAAGG + Intergenic
1119940652 14:78637564-78637586 TATTCCCATTTTGTAGATTAGGG + Intronic
1121939499 14:98056112-98056134 TGCTCCATTTTCGTGGATTATGG + Intergenic
1124183179 15:27497655-27497677 TGTTCCTATTTCTTTGATTAGGG + Intronic
1128490552 15:68138326-68138348 CACTCCTATTTCATTGACCAAGG + Intronic
1203172739 17_GL000205v2_random:165125-165147 TTCTCCTCTTTGGTTGATTTGGG - Intergenic
1158368190 18:56764819-56764841 TACTCTTATTTAATTGATAAAGG - Intronic
925602474 2:5623143-5623165 TACTTCTATTTCTTTGTTTCTGG - Intergenic
931206534 2:60151011-60151033 AAGTCCTATATCGTTGATGATGG + Intergenic
944150636 2:196554517-196554539 TCCTCCTCATTCTTTGATTAAGG - Intronic
945648261 2:212528424-212528446 TGCTCCTATTTTGTAGATGAGGG - Intronic
1169394626 20:5218675-5218697 TCCTCCCATTTCTTTGCTTATGG - Intergenic
951703120 3:25516114-25516136 TACTCCTAGTTCCCTGACTATGG + Intronic
952153374 3:30616930-30616952 TATTCCTCTTTGGTTAATTATGG + Intronic
953800642 3:46020033-46020055 TCCTCCTATTTGGTTGATGGTGG - Exonic
955079312 3:55643277-55643299 TACTGATATTTCCTTGATTGTGG + Intronic
956582922 3:70834132-70834154 TACACAAATTTCCTTGATTAAGG - Intergenic
976562953 4:86522612-86522634 TGCTCTTATTTCGTTGGTTCTGG + Intronic
980717761 4:136650336-136650358 TAATCCTATTTCCTTTTTTATGG + Intergenic
980748979 4:137063685-137063707 TACTCTTATTTCCTTCATTTAGG + Intergenic
988684166 5:33511926-33511948 TCATCCTATGTCATTGATTAAGG - Intergenic
988787068 5:34574891-34574913 TATTCCTATTTTGTAGATAAGGG - Intergenic
989781598 5:45272070-45272092 TACTCTTTTTTCGTTGCTAAGGG - Intronic
996874967 5:128230264-128230286 TACTATTATTTTTTTGATTATGG + Intergenic
1001677363 5:173529781-173529803 AACTCCAATTTTGTTGATGATGG + Intergenic
1008713160 6:54254596-54254618 TGTTGCTATTTTGTTGATTAAGG - Intronic
1009557834 6:65197308-65197330 TACTTCTTTTTGCTTGATTAAGG + Intronic
1009572757 6:65409504-65409526 TACTCCTCTTACCTTGAGTAAGG + Intronic
1012322762 6:97871356-97871378 TGGTCCTATTTTGTGGATTAAGG - Intergenic
1019361426 7:606203-606225 AACTTCTATGTCGTTGATCAAGG - Exonic
1021187485 7:17582089-17582111 TACTCCTTTTCTGTTGATTGTGG - Intergenic
1026362515 7:69615656-69615678 TACTCTTATTTTGTTTAGTATGG + Intronic
1031825908 7:126564959-126564981 TGCTTCTATTTGGATGATTATGG - Intronic
1039074660 8:33679138-33679160 TACTGTTTTTTCTTTGATTATGG - Intergenic
1040058373 8:43082408-43082430 TTCTCCTATTTCAGTGACTAGGG + Intronic
1048125016 8:131624745-131624767 TACTCCAATTCCATTGGTTAAGG - Intergenic
1048332875 8:133483023-133483045 TAATCCTATTTTGTAGATTCAGG - Intronic
1050654115 9:7806940-7806962 TACTCCTTTTTCCTGGATTCTGG + Intronic
1050659691 9:7870216-7870238 TACTTCTATTTCTTTGTTTATGG + Intronic
1054964910 9:71013127-71013149 AATTCCTATTTTGTTGATTTTGG + Intronic
1055542548 9:77327194-77327216 TCCTGCTTTTTAGTTGATTAGGG + Intronic
1056942594 9:90968139-90968161 TACTCCAATTTCCTAGATTGAGG + Intergenic
1059403960 9:114088662-114088684 TACTCTTATTGCGTTCATTCTGG + Intronic
1203433377 Un_GL000195v1:113554-113576 TTCTCCTCTTTGGTTGATTTGGG + Intergenic
1190682435 X:52839160-52839182 TATTGCTATTTATTTGATTAAGG - Intergenic
1191145871 X:57164692-57164714 TGCTCATATTTCTTTGACTAGGG - Intergenic
1194845677 X:98805237-98805259 TACTTCTATTTCTTTAACTAAGG - Intergenic