ID: 911434576

View in Genome Browser
Species Human (GRCh38)
Location 1:97840302-97840324
Sequence AGCCCAGTGCTGTAATATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911434570_911434576 23 Left 911434570 1:97840256-97840278 CCAGAACACCCTCTCCCTTAATC 0: 1
1: 0
2: 0
3: 20
4: 167
Right 911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG No data
911434574_911434576 9 Left 911434574 1:97840270-97840292 CCCTTAATCAACGAAATAGGAGT No data
Right 911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG No data
911434575_911434576 8 Left 911434575 1:97840271-97840293 CCTTAATCAACGAAATAGGAGTA 0: 1
1: 0
2: 0
3: 4
4: 67
Right 911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG No data
911434572_911434576 14 Left 911434572 1:97840265-97840287 CCTCTCCCTTAATCAACGAAATA 0: 1
1: 0
2: 0
3: 8
4: 94
Right 911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG No data
911434571_911434576 15 Left 911434571 1:97840264-97840286 CCCTCTCCCTTAATCAACGAAAT No data
Right 911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG No data
911434569_911434576 24 Left 911434569 1:97840255-97840277 CCCAGAACACCCTCTCCCTTAAT 0: 1
1: 0
2: 0
3: 16
4: 170
Right 911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911434576 Original CRISPR AGCCCAGTGCTGTAATATTT TGG Intronic
No off target data available for this crispr