ID: 911435091

View in Genome Browser
Species Human (GRCh38)
Location 1:97845896-97845918
Sequence CTGCAGCCTCACATGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911435085_911435091 27 Left 911435085 1:97845846-97845868 CCACGTGTGGGTGCATACAGCAG No data
Right 911435091 1:97845896-97845918 CTGCAGCCTCACATGGAGCCGGG No data
911435087_911435091 1 Left 911435087 1:97845872-97845894 CCGCATGTGGTACATCTGATCCA 0: 3
1: 6
2: 20
3: 56
4: 179
Right 911435091 1:97845896-97845918 CTGCAGCCTCACATGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911435091 Original CRISPR CTGCAGCCTCACATGGAGCC GGG Intronic
No off target data available for this crispr