ID: 911436983

View in Genome Browser
Species Human (GRCh38)
Location 1:97872981-97873003
Sequence CTGAAAATAAAGATGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 832
Summary {0: 1, 1: 0, 2: 5, 3: 78, 4: 748}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911436983_911436988 -1 Left 911436983 1:97872981-97873003 CCCTCCTTCATCTTTATTTTCAG 0: 1
1: 0
2: 5
3: 78
4: 748
Right 911436988 1:97873003-97873025 GTTTAAATTCTGGTTCCTCAGGG No data
911436983_911436987 -2 Left 911436983 1:97872981-97873003 CCCTCCTTCATCTTTATTTTCAG 0: 1
1: 0
2: 5
3: 78
4: 748
Right 911436987 1:97873002-97873024 AGTTTAAATTCTGGTTCCTCAGG 0: 1
1: 0
2: 2
3: 27
4: 233
911436983_911436989 2 Left 911436983 1:97872981-97873003 CCCTCCTTCATCTTTATTTTCAG 0: 1
1: 0
2: 5
3: 78
4: 748
Right 911436989 1:97873006-97873028 TAAATTCTGGTTCCTCAGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 191
911436983_911436992 26 Left 911436983 1:97872981-97873003 CCCTCCTTCATCTTTATTTTCAG 0: 1
1: 0
2: 5
3: 78
4: 748
Right 911436992 1:97873030-97873052 CAACCTTGAATTCTGAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911436983 Original CRISPR CTGAAAATAAAGATGAAGGA GGG (reversed) Intronic
900506260 1:3031092-3031114 CTGAAAGTAAATGTGGAGGAGGG - Intergenic
901309907 1:8261397-8261419 CCTAAAACAAAGAAGAAGGAAGG - Intergenic
901329464 1:8394066-8394088 CAGAAAGACAAGATGAAGGATGG + Intronic
901370405 1:8792854-8792876 CGGAACATAAAGAAGCAGGAAGG + Intronic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
902698164 1:18154331-18154353 CTGAAAAAAAAGATGTAAAATGG - Intronic
902731528 1:18373098-18373120 CTGAAAATGACAATGGAGGAGGG - Intronic
903197829 1:21706012-21706034 GTGAAAGTAACCATGAAGGAAGG + Intronic
903623330 1:24713864-24713886 CTGAAAAAAAAAAAAAAGGAAGG - Intergenic
903879975 1:26501529-26501551 TTGAAACTGAATATGAAGGAGGG - Intergenic
904666837 1:32129145-32129167 AAGAAAAAAAAGAGGAAGGAAGG - Intronic
904899799 1:33847935-33847957 CTGGAAATCAAGATGAAGAATGG - Intronic
904919604 1:33996740-33996762 CAGAAAAGAAAAAGGAAGGAAGG + Intronic
904973914 1:34441508-34441530 CTGAATATGAAAATGAAGGAGGG - Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
905658993 1:39706224-39706246 CTGAAAAAAAGAAGGAAGGAAGG - Intronic
906420770 1:45664986-45665008 CTGTTAAAAAAGATGAAAGATGG + Intronic
906657349 1:47558303-47558325 TTGAAAAAAAGGATGAAGGAAGG + Intergenic
907184244 1:52597543-52597565 CTAAAAATAAAAATAAAGGTAGG - Intergenic
907933094 1:59018349-59018371 CTGACTTTGAAGATGAAGGAAGG + Intergenic
908317484 1:62947388-62947410 CAGAAAATAAAAATGAAGGGTGG - Intergenic
908556849 1:65264921-65264943 CTGAAAATAAAGGTAAGGGGCGG + Intronic
909565886 1:77053174-77053196 TTCAAAATAAAGATAAAAGAGGG - Intronic
909626362 1:77720210-77720232 GTGGAAAAAAAGATAAAGGATGG + Intronic
909909074 1:81238364-81238386 ATGAAAGTAAACATGAAGGAAGG - Intergenic
910274662 1:85436153-85436175 CTAAAAATAAAGGTGAAAAAAGG + Intronic
910280871 1:85500093-85500115 AAGAAAAGAAAGAGGAAGGAGGG - Intronic
910562853 1:88611032-88611054 ATGTAAATAAAAATGAGGGAAGG - Intergenic
911226357 1:95309724-95309746 CTAAAAATAAAAATGAGGAAAGG - Intergenic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911610796 1:99957517-99957539 TAAAAAATAAAGATGAATGATGG - Intergenic
911709206 1:101049922-101049944 CTGAAAATAGAGATGAGCCAAGG + Intergenic
911767508 1:101695761-101695783 CTGAAAATAAAGAGGATGTAAGG - Intergenic
911883933 1:103273364-103273386 TTGAAAGTAAGGATTAAGGAGGG - Intergenic
912144894 1:106781629-106781651 AAGAAAGAAAAGATGAAGGAAGG + Intergenic
912396080 1:109344991-109345013 CAAAAAATAAATATGAAGGCTGG - Intronic
912628077 1:111222787-111222809 ATGAAAATAAAAATAAAGGAAGG - Intronic
913533737 1:119751701-119751723 ATGAAAATAAAAATGGAGCAGGG - Intronic
913561116 1:120020939-120020961 GTGAAAATAAAGACTAAGAAAGG - Intronic
913637011 1:120772663-120772685 GTGAAAATAAAGACTAAGAAAGG + Intergenic
914542744 1:148631287-148631309 GTGAAAATAAAGACTAAGAAAGG - Intronic
914623890 1:149439956-149439978 GTGAAAATAAAGACTAAGAAAGG + Intergenic
914786980 1:150842499-150842521 ATTAAAATAAAAAAGAAGGAAGG + Intronic
915105827 1:153534677-153534699 CTGAAAATAAATAGGGAAGATGG - Exonic
915920977 1:159974800-159974822 CTGAGGATCATGATGAAGGATGG + Intergenic
915933429 1:160075141-160075163 CTGGAGAGAAAGGTGAAGGATGG - Intergenic
916051862 1:161042059-161042081 CTGAGAAGTAAGATGAAGAAGGG - Intronic
916619805 1:166484840-166484862 CTGACAATAAAGATGAGGACTGG + Intergenic
916820664 1:168395089-168395111 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
918445032 1:184609022-184609044 CTGAAAGCAAAGAGAAAGGAAGG + Intronic
918670774 1:187212698-187212720 CAGAATATAAAGAAGAAGAAAGG + Intergenic
918834068 1:189436887-189436909 CTGAAAATAAAAATAAAAAATGG - Intergenic
918982111 1:191575794-191575816 CTGCAGAGAAAGATGAAGGGAGG + Intergenic
919325402 1:196100400-196100422 CTGAAAGGAAAGATGAAGGCTGG + Intergenic
919468261 1:197948316-197948338 CCCAAAACAAAGATGCAGGAAGG + Intergenic
919503744 1:198371545-198371567 ATAAAAAAAAAGAGGAAGGAGGG + Intergenic
919634859 1:199993655-199993677 TAGAAAATAAAAATGAAGGCTGG - Intergenic
920139916 1:203802525-203802547 CAGATAATAAAGATGGGGGAAGG + Exonic
920341552 1:205278273-205278295 GAGAAAATGAAGAAGAAGGAAGG - Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920859391 1:209692984-209693006 CTGAAAATAAAAGAGAATGAAGG - Intronic
921200598 1:212801864-212801886 GAGAGAACAAAGATGAAGGAGGG - Intronic
921530004 1:216270354-216270376 CAGAAAATAAATATAAATGAGGG + Intronic
921598744 1:217084155-217084177 CAGGAAAGAAAGAGGAAGGAAGG + Intronic
921728828 1:218553980-218554002 CTGAAAATTAAGATCATGAAAGG - Intergenic
922069266 1:222174879-222174901 GCGAAGACAAAGATGAAGGAAGG - Intergenic
922088204 1:222370806-222370828 CAGAAATTAAAGATTGAGGAGGG + Intergenic
922273959 1:224059271-224059293 CTGAAAATAGAGAAGAGGAAAGG + Intergenic
922953382 1:229578342-229578364 AGGAAAAGAAAGAGGAAGGAAGG - Intergenic
923327019 1:232888938-232888960 AAGAAAATAAAGAAGAAGGAAGG - Intergenic
924005156 1:239600812-239600834 GTGAAAGTAAAGAGGAAGGAAGG - Intronic
1063426292 10:5952728-5952750 CTGAAAGTTAGGATGAGGGACGG + Exonic
1063863406 10:10337663-10337685 CTGAAAATAAAGATATAGAAAGG - Intergenic
1064870683 10:19933750-19933772 CTGAAAAGGAAGATAAAGTATGG + Intronic
1065012416 10:21431597-21431619 CTCAAAAAAAAGAAAAAGGAAGG - Intergenic
1065441858 10:25761316-25761338 CTGAAATTACAGATGGAGGCTGG + Intergenic
1066225529 10:33379182-33379204 CTAAAAATAAAGAATAAAGAAGG - Intergenic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1068309674 10:55262123-55262145 AAGAAAAGAAAGATGAAGGAAGG + Intronic
1068793577 10:61053260-61053282 CTGGACATAAAGATGAAGAATGG + Intergenic
1068876100 10:61998523-61998545 CTCAAGCTTAAGATGAAGGAAGG + Intronic
1068964215 10:62895553-62895575 CTGTAATGAAAGAAGAAGGAGGG + Intronic
1070597988 10:77846243-77846265 CTCAAAAAAAAGACGAAGAATGG + Intronic
1071481159 10:86066078-86066100 CTGAAAAGACAGATTAAAGAGGG + Intronic
1071496486 10:86170830-86170852 CTGAAAATAGACAGGAAGCACGG - Intronic
1071998275 10:91168291-91168313 CTGAGAAGAAAGAAGCAGGAGGG + Intronic
1072071088 10:91918211-91918233 CTGAAAGTAGAGATGAAAGAAGG - Intergenic
1072301006 10:94062271-94062293 ATGAAAAAAAACAAGAAGGAAGG - Intronic
1072352040 10:94566469-94566491 GTGAAAAGAGTGATGAAGGAAGG + Intronic
1072923096 10:99593243-99593265 CTGAAGATAAAGAGAAAGAAAGG + Intergenic
1072976204 10:100061048-100061070 ATGAAAATAAAGAGGAAGGATGG + Intronic
1073988492 10:109236806-109236828 ATGAAAATAAGGCAGAAGGATGG + Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1075393540 10:122110993-122111015 CTGACTTTGAAGATGAAGGAAGG - Intronic
1076185906 10:128448567-128448589 CTGATAATGAAGATGGAGGCAGG + Intergenic
1077345566 11:2049157-2049179 TGGAAAATAAAGATGGAGAATGG - Intergenic
1077743567 11:4875567-4875589 TTGACATTGAAGATGAAGGAAGG - Intronic
1077857303 11:6141552-6141574 CCGAAAATAGAGATGACAGATGG + Intergenic
1078264853 11:9747353-9747375 CTGATAATGAAGATGAAGAAAGG - Intronic
1078303669 11:10160370-10160392 CTGAAAATAGAGATTAGGGATGG - Intronic
1078509026 11:11972152-11972174 TTAAAAACAAAGATGAAGGCAGG + Intronic
1079072157 11:17356656-17356678 CTGAAAGTAGAGATGATGGCAGG + Exonic
1079414766 11:20223421-20223443 CAGAGAAGAAAGATGTAGGAAGG - Intergenic
1079518332 11:21294188-21294210 GTGAAGCTAAAGATGTAGGAGGG - Intronic
1079672996 11:23190360-23190382 AGGAAAATAAAGATAAAGAATGG - Intergenic
1079770226 11:24449356-24449378 CTTATAATAAGGATGAAGGCAGG + Intergenic
1080048932 11:27838586-27838608 GAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1080123471 11:28704044-28704066 CTGGAAAAAAGGAGGAAGGAAGG - Intergenic
1080288541 11:30644340-30644362 CTGAAAAGAAACAAGAAAGATGG + Intergenic
1080947285 11:36988073-36988095 CTGAAAATCAAGAAGAAAAATGG + Intergenic
1081076575 11:38681807-38681829 TTTAAAATAAAGATAAAAGATGG + Intergenic
1081233887 11:40621638-40621660 CTGAATTTCAAGATGCAGGAGGG + Intronic
1081405984 11:42698305-42698327 ATGAAAAAAGAAATGAAGGAAGG + Intergenic
1081947833 11:47014338-47014360 CAGAAAAGAAAGAGAAAGGAAGG + Intronic
1083839388 11:65295288-65295310 CTCATAATCAAGATCAAGGAAGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084773455 11:71359118-71359140 GTGAATAGAAAGATGATGGATGG - Intergenic
1084958971 11:72706269-72706291 CTGGGTAGAAAGATGAAGGAGGG - Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085360426 11:75880373-75880395 CTGAAAATTAAGTTGAAATAAGG + Intronic
1085459617 11:76685763-76685785 CAGAAACTCAAGATGGAGGAGGG - Intergenic
1085851846 11:80129912-80129934 TTGAAAATAAAGCTAAAGAAAGG - Intergenic
1086048201 11:82557955-82557977 CTGAACAAAAACATGAAGCAGGG + Intergenic
1086092071 11:83014849-83014871 AAGAAAAGAAAGAGGAAGGAAGG + Intronic
1086906382 11:92422699-92422721 CTGAAAAGAAGGCTGAAGGTGGG + Intronic
1087448025 11:98279912-98279934 AGGAAAATGAAGATGAAGAATGG - Intergenic
1087477799 11:98659293-98659315 CTAAAAATAAATAAGAAGAATGG - Intergenic
1087698256 11:101406307-101406329 CTGGAAAGAATGATGAAGGGGGG - Intergenic
1088229967 11:107663530-107663552 CTGTAAATATAGGAGAAGGAGGG - Intronic
1089047373 11:115514339-115514361 TTGTAAAGAAAGATGAAGGCAGG - Intergenic
1089445216 11:118546483-118546505 CTGTAAAAAAAAAGGAAGGAAGG + Intronic
1089469799 11:118711530-118711552 CTGAAAATACAGGTAATGGAAGG + Intergenic
1090072049 11:123552180-123552202 CTGAAAATCTAGAAAAAGGAGGG + Intronic
1090082882 11:123626145-123626167 CTACCAATAAAGAGGAAGGATGG - Intronic
1090235240 11:125142094-125142116 CTGAACATAAAGCTTGAGGAAGG + Intergenic
1091003412 11:131930340-131930362 TTGAAAATAAGCATGGAGGAAGG - Intronic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1092167890 12:6354297-6354319 CTGAAAAACAAGAGCAAGGAAGG + Intronic
1092967743 12:13661038-13661060 CTGAAATTAGAAATGAAGGCAGG - Intronic
1093409626 12:18848878-18848900 ATGAAAATTGAGATAAAGGATGG + Intergenic
1093558679 12:20510821-20510843 CTGAGAGTGAAGAGGAAGGAAGG + Intronic
1093568415 12:20636027-20636049 AAGAAAAGAAAGATGAAGGAAGG + Intronic
1094034753 12:26056269-26056291 CTTAAAATAAATAAGAAGAAAGG - Intronic
1094386902 12:29904438-29904460 TTAAAAATCAAGATGAATGATGG - Intergenic
1095153391 12:38822433-38822455 AGAAAAATAAACATGAAGGAAGG + Intronic
1095174136 12:39071264-39071286 CTGAAAAGACAGATCCAGGATGG - Intergenic
1095311527 12:40703374-40703396 CTAAAAATAACGATGAAAGCAGG - Intronic
1095516090 12:43007115-43007137 CTGAGAGTGAAGATGAGGGAGGG - Intergenic
1095604629 12:44052392-44052414 CAGAAAAGAAAGAACAAGGAGGG + Intronic
1095946828 12:47758546-47758568 TTGAAAAGAAACATGAAGGTGGG - Exonic
1097042624 12:56164732-56164754 CTGAGAATAAAGATGAGAGATGG + Intronic
1097318792 12:58202629-58202651 TTGAACAAAAAGATGGAGGAAGG - Intergenic
1097325138 12:58267882-58267904 CTTAAAAAAAAAATAAAGGAAGG + Intergenic
1097344948 12:58480787-58480809 TTGAAAATAAAGATTTAAGAAGG - Intergenic
1097864454 12:64547946-64547968 CTGAAAAAAGAGAGGAATGAAGG - Intergenic
1098170853 12:67745426-67745448 CTGTGAAGGAAGATGAAGGAAGG - Intergenic
1098328862 12:69331920-69331942 CGGAAAACAAAGGTGAAGAAAGG - Intergenic
1098364099 12:69684263-69684285 CTGATTAGAAAGATGAAGGAGGG - Intronic
1098769006 12:74528690-74528712 CAGAAAAAAAAGAAGAATGATGG - Intergenic
1099149479 12:79091166-79091188 CTGAAAATAAATTTCAAAGAGGG - Intronic
1099246408 12:80198022-80198044 CAGAAAACAAAGAGGAAGAAAGG - Intergenic
1099663711 12:85598673-85598695 CTGAAAATGAAAATGAGGGAAGG + Intergenic
1099862985 12:88243146-88243168 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
1100042055 12:90331748-90331770 TTAATAATAATGATGAAGGAAGG - Intergenic
1101774262 12:107779370-107779392 CTGAAAAAAAAATTGAGGGAGGG + Intergenic
1102548563 12:113674274-113674296 CAGAAAAGAGAGAGGAAGGAAGG - Intergenic
1102744287 12:115236601-115236623 GTGAAAATAAAGCTGAATGGTGG + Intergenic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1105299770 13:19121816-19121838 CAAAAAATGAAGAGGAAGGAAGG - Intergenic
1105681975 13:22737255-22737277 AGGAAATTAAAGATGAAGTAGGG - Intergenic
1105720055 13:23104112-23104134 TTGAAAATAATGATGCAGGCTGG - Intergenic
1106850039 13:33780526-33780548 TTGAAAATAAATGTGAAGCATGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107387994 13:39933286-39933308 CTAAAAATGAAGTTGAAGTAGGG + Intergenic
1107560604 13:41553890-41553912 CTGAAGACAAACCTGAAGGAAGG - Intergenic
1107703464 13:43073950-43073972 CAAAAAAAAAAGAAGAAGGATGG - Intronic
1107712741 13:43166748-43166770 CTGAAAATACAGAGGATGGATGG + Intergenic
1107793978 13:44031215-44031237 CTCAAAAAAAAGAAGAAAGATGG - Intergenic
1107962416 13:45570299-45570321 CTGAAATAAAAAATGAAGGCTGG + Intronic
1108009679 13:45992790-45992812 CAGAACAAAAAGGTGAAGGAAGG + Intronic
1108237985 13:48428701-48428723 ATGAAGCTAAAAATGAAGGATGG - Intronic
1108337465 13:49460193-49460215 CTGAAACAAAAGATCAAAGATGG + Exonic
1108337473 13:49460394-49460416 CTAAAAAAAAAGATAAATGAGGG - Intronic
1108558834 13:51623221-51623243 CTAAAAAAAAAAATGAAGGTAGG + Intronic
1108696377 13:52906081-52906103 CTGAAAAAAAATCTAAAGGAAGG + Intergenic
1108943501 13:55989487-55989509 TTGAAAGTAAAAATGAAGGCAGG - Intergenic
1109095531 13:58109407-58109429 CTGAAATTAAAATTGAAGTATGG + Intergenic
1109365322 13:61348282-61348304 CTGGCATTGAAGATGAAGGAAGG - Intergenic
1109371911 13:61433137-61433159 ATGAAGAAAAAAATGAAGGAAGG - Intergenic
1110218951 13:73052563-73052585 CAGAAATTAAAGTGGAAGGAGGG - Intergenic
1110247709 13:73345454-73345476 CTAGAAATAGAAATGAAGGAAGG - Intergenic
1111105482 13:83640423-83640445 CTGAACATAAAGAACAAAGATGG - Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111747418 13:92287944-92287966 GTGAAAATAAAAAAGAATGAAGG - Intronic
1112142501 13:96660957-96660979 CACAAAAGAAAGATGAAGGCTGG - Intronic
1112509362 13:99996215-99996237 CTAAAAATAATAATAAAGGAAGG - Intergenic
1112614550 13:100990003-100990025 CTGAAAATGAGAATGTAGGAAGG - Intergenic
1112814610 13:103257337-103257359 GGGAAAATAAAGAGGAAGGAGGG - Intergenic
1113001606 13:105644895-105644917 CTGAAAGAAAAAAGGAAGGAAGG - Intergenic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1114152218 14:20055367-20055389 GAGAAAATAAAGATGATGTAAGG - Intergenic
1114787287 14:25615526-25615548 AAGAAAATAAAGAGAAAGGAAGG - Intergenic
1115201653 14:30860379-30860401 CTGATCATAAAGATGCAGGTGGG + Intergenic
1115229310 14:31141857-31141879 GTGAAAATGAAGATGATGAAAGG - Exonic
1115742503 14:36403341-36403363 CAGAACAAAAAGGTGAAGGAGGG + Intergenic
1115833344 14:37367521-37367543 CTGAAGAAAAAGAGGAAGCATGG - Intronic
1115854936 14:37621227-37621249 CTGAAAAAAAAGAAAAATGAAGG - Intronic
1116236774 14:42288450-42288472 CTAAGAAAAAAGATGAAGTAAGG + Intergenic
1116794312 14:49373658-49373680 CTAAAAATAAAAATAAAAGATGG + Intergenic
1117393111 14:55281543-55281565 CAGAAAATGAAGAGGAAGGGTGG - Intronic
1118234691 14:63991839-63991861 GGGGAAATAAAGATGCAGGAAGG + Intronic
1118285862 14:64471446-64471468 TTGAAAATAGTGATGAAGGCCGG - Exonic
1119031690 14:71197554-71197576 CTGAAAGCAAGGATGAAGGCTGG + Intergenic
1119484362 14:74978321-74978343 CTGAAAAAAAGGAAAAAGGAGGG + Intergenic
1119852536 14:77876262-77876284 CTGGCTGTAAAGATGAAGGAAGG - Intronic
1119894257 14:78206510-78206532 CTGTAAATAAAGAGGAACAAAGG + Intergenic
1120447016 14:84611812-84611834 CCAAAAATAAAGATGTAGGTCGG + Intergenic
1120490252 14:85169062-85169084 CTTAAATTAAGGATGAAGCACGG - Intergenic
1120634305 14:86931998-86932020 CTAAAAATGAAGATGCAGGCCGG - Intergenic
1120726864 14:87953255-87953277 CTCAAAAGAAAGATAAAGGGCGG + Intronic
1120792697 14:88599719-88599741 ATGAAAATAATGCTGAAGGTGGG - Intronic
1121073672 14:91048678-91048700 CTGAAAAACAAGATGAATGTAGG + Intronic
1122426726 14:101613406-101613428 ATAAAAATAAAAATGAAAGATGG + Intergenic
1122515421 14:102305011-102305033 CGGAAAAGAAAGAAGCAGGAAGG + Exonic
1202847796 14_GL000009v2_random:197156-197178 CTGAAAATAAAGATTAACCAGGG + Intergenic
1202917270 14_GL000194v1_random:187696-187718 CTGAAAATAAAGATTAACCAGGG + Intergenic
1124063819 15:26320995-26321017 CTGAAGATAAAGATTAAAAATGG + Intergenic
1124205239 15:27712932-27712954 CTGGCTATAAAGATGGAGGAGGG + Intergenic
1124883908 15:33666396-33666418 CTGAGAATAAAAATGAAAGAAGG + Intronic
1125190812 15:36990576-36990598 CAAAAAAGAAAGATGAAAGAAGG + Intronic
1125437612 15:39664410-39664432 CTGTAAATAAATATGATGAATGG - Intronic
1125810071 15:42531619-42531641 CAGAAAACAAAAAAGAAGGAGGG - Exonic
1126775429 15:52096287-52096309 CTGGAATTAAAGATGATGGTTGG + Intergenic
1126919953 15:53510162-53510184 CTGAAAAAAAGAAGGAAGGAAGG - Intergenic
1127402487 15:58603565-58603587 ATGAAAGTAAAGATGAAGGAAGG - Intronic
1128019369 15:64376883-64376905 CTGAAAATAAATATGCAGGAGGG - Exonic
1128407121 15:67353698-67353720 CTGACAATAATGATAAAGAAAGG + Intronic
1129025239 15:72565798-72565820 CTGAAAAGAAAGATGGGGAATGG - Intronic
1129712928 15:77830180-77830202 CTGGAAGTCAAGAAGAAGGAAGG + Intergenic
1130135656 15:81179694-81179716 CTGACTTTAAAGATGCAGGAAGG - Intronic
1131391853 15:92056167-92056189 CTGGAAATAAAGGGGAAAGAAGG - Intronic
1131551588 15:93361998-93362020 CTGGAAATAAACATGGGGGAGGG - Intergenic
1131813738 15:96201264-96201286 CCGAAAATAGAGACGTAGGAAGG - Intergenic
1131901360 15:97091380-97091402 CAGCAAATAAAAATGAAAGAAGG - Intergenic
1132113545 15:99119466-99119488 CTGGAAGACAAGATGAAGGATGG + Intronic
1132195610 15:99912537-99912559 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1133556493 16:6910898-6910920 CTGTTAGTAAAGAGGAAGGAGGG + Intronic
1133573783 16:7067983-7068005 CTGGCTTTAAAGATGAAGGAAGG - Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1134329395 16:13236625-13236647 CAGAAAAAGAAGAGGAAGGAAGG - Exonic
1134337641 16:13316057-13316079 CCCAAGCTAAAGATGAAGGATGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135521513 16:23182187-23182209 AGGAAAAGAAAGAAGAAGGAAGG + Intergenic
1135536027 16:23295217-23295239 CTCAAAAAAAAAATGAAGTAAGG - Intronic
1135689699 16:24526363-24526385 CTTCAAGTAAACATGAAGGAGGG - Intergenic
1135715234 16:24759063-24759085 CTCAAAAAAAAGATGAATAAAGG + Intronic
1136129286 16:28209666-28209688 CTGAAAGAATAAATGAAGGAAGG + Intronic
1136470685 16:30478002-30478024 AGAAAAAGAAAGATGAAGGAAGG + Intronic
1138075075 16:54034112-54034134 CTGAAAATAAAAATTAAAGGTGG + Intronic
1138145171 16:54602612-54602634 CGTATAATAAATATGAAGGAAGG - Intergenic
1138384563 16:56627355-56627377 CAGAAAATAAAAAGGAGGGAAGG - Intergenic
1138390393 16:56666471-56666493 CTGAGAATAAACATGAGGAATGG + Intronic
1138391263 16:56671376-56671398 CTGAGAATAAACATGAGGAATGG - Intronic
1138766411 16:59610424-59610446 CTGAAAAGGAATATGAAGGCTGG + Intergenic
1138845846 16:60564767-60564789 CTGGGAATAAATATGGAGGAGGG + Intergenic
1139744340 16:69062364-69062386 CTAATAATAAGGATGCAGGATGG - Intronic
1141209712 16:81965832-81965854 TTGAAAATAAAAATGAAAAAAGG - Intergenic
1141279004 16:82613861-82613883 CTGAGAATGAGGATGAATGAAGG - Intergenic
1141342898 16:83219589-83219611 ATGATATTAAAGGTGAAGGAAGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141421120 16:83916292-83916314 ATGAGAACAAAGGTGAAGGAAGG + Exonic
1141734694 16:85844341-85844363 CTAAAAAAAAAAAAGAAGGAAGG - Intergenic
1142085266 16:88176627-88176649 ATGAAAAAAAAAATGAAGGTGGG + Intergenic
1142971040 17:3611719-3611741 CTGAAAAGCAAGTTGTAGGATGG - Intronic
1143249427 17:5511811-5511833 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1146292660 17:31621747-31621769 CAGAAAGTAAAGATTAAGGTAGG - Intergenic
1147052387 17:37805271-37805293 CAAAAAATAAAGATGTTGGAAGG + Intergenic
1147528693 17:41253018-41253040 CCAAAAAAAAACATGAAGGAAGG + Intronic
1148180709 17:45602580-45602602 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1148268194 17:46243346-46243368 AAGAAAAGAAAGAAGAAGGAAGG + Intergenic
1148514630 17:48204947-48204969 AAGAAAAGAAAGAGGAAGGAGGG - Intronic
1148661945 17:49341320-49341342 CTGAAAAAAAAAAAGATGGATGG + Intronic
1148947982 17:51282462-51282484 ATGAAGAGAAAGAGGAAGGAAGG + Intronic
1148987129 17:51632744-51632766 GTGGAAAGAAAGATGGAGGAAGG - Intronic
1149979096 17:61295274-61295296 TTGAGAATAAAGTTTAAGGAAGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150854457 17:68737785-68737807 CTGAAAATAACTAGGAAAGATGG + Intergenic
1150953085 17:69824107-69824129 ATGAGAGTAAAGATGTAGGAAGG - Intergenic
1151288353 17:73129935-73129957 CTTAAAAAAAAAATGAAGTAAGG - Intergenic
1151603692 17:75122978-75123000 CTGTAATTTAAGATGAAGGAGGG - Intronic
1151632444 17:75320098-75320120 ATGAAAAAAAAGACAAAGGAGGG + Exonic
1151709417 17:75793656-75793678 CTGTGAATAAAGAATAAGGAAGG - Intronic
1151764131 17:76123366-76123388 CTGAAAAAGAAAAAGAAGGAAGG - Intergenic
1152061100 17:78075874-78075896 TTGAAAATAAAATTGAAGTAAGG + Intronic
1153546264 18:6208583-6208605 CTACAAATAAAGATAAAGGAAGG - Intronic
1153747271 18:8192618-8192640 CTGAAAATAAATAGAAAGGATGG + Intronic
1153905880 18:9660661-9660683 CTCAAAATAAAAACGAAGGAAGG + Intergenic
1154957836 18:21276667-21276689 CTTACAATAAAGCAGAAGGAAGG - Intronic
1155105087 18:22656011-22656033 CTGAAAATAGAGATTAAGTAAGG - Intergenic
1155130684 18:22931905-22931927 GTGAAAACAAAGATTTAGGAGGG + Intronic
1155321948 18:24628213-24628235 GTGATAATAAACAAGAAGGAGGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155799631 18:30084528-30084550 CTGAAAATAAAGTGGAAGAGAGG + Intergenic
1155799632 18:30084626-30084648 CTGAAAATAAAGTGGAAGAGAGG - Intergenic
1156417637 18:36914073-36914095 CTGAAAATATACAAGAAGGAAGG + Intronic
1156759881 18:40575650-40575672 CTGAAAATATAGTTGAAAGGTGG + Intergenic
1157479959 18:48047453-48047475 ATGAAAATAAAGGAGAAAGATGG + Intronic
1157897835 18:51485396-51485418 ATGAACATAAAGATGAACGGGGG - Intergenic
1158060921 18:53340416-53340438 CTGCAAAAGAAGATGAAAGAAGG + Intronic
1158189076 18:54804975-54804997 CTAAAAAAAAAAAGGAAGGAAGG - Intronic
1158226905 18:55210859-55210881 GAGATAATAAAGATGAAGTAAGG + Intergenic
1158239668 18:55362328-55362350 CAAAAAAAAAAGAGGAAGGAAGG + Intronic
1158371172 18:56806207-56806229 AAGAAAATAAAAATGAAGGTAGG - Intronic
1158731188 18:60024346-60024368 ATGAATGTAAAGATGCAGGATGG + Intergenic
1158814403 18:61077027-61077049 CTGAATATAAATATAGAGGATGG - Intergenic
1158928581 18:62297419-62297441 ATGAAAATATAGAAGAAAGAAGG + Intronic
1159311279 18:66713891-66713913 ATAAAAATGTAGATGAAGGAAGG + Intergenic
1159517733 18:69479268-69479290 ATGAGAATAAAAATCAAGGAAGG + Intronic
1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG + Intergenic
1160128979 18:76207131-76207153 CTGAGATTGTAGATGAAGGAAGG + Intergenic
1162504408 19:11074577-11074599 CTTAAAAAAAAAAAGAAGGAAGG + Intergenic
1163244642 19:16085766-16085788 CTGGTAGTAAAGATGAAGGGAGG + Intronic
1163347722 19:16754444-16754466 TGGAAAATAGAGATGATGGATGG - Intronic
1163680915 19:18682006-18682028 CTCAAAACAAAGATAAAGTAGGG + Intergenic
1164092143 19:21966254-21966276 CTAAAAAGAAGGAGGAAGGATGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165179508 19:33955722-33955744 CTCAAAATAAAGAGAAAGGAAGG - Intergenic
1165186182 19:34024185-34024207 GGGCCAATAAAGATGAAGGAAGG - Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1166415942 19:42595030-42595052 CAGAAAATAAAGGGAAAGGAGGG - Intronic
1166907963 19:46127348-46127370 TTGCAAAGAAAGAAGAAGGAAGG + Intergenic
1167217816 19:48176569-48176591 ATTGAAATAAAGATGAGGGAAGG - Intronic
1168558204 19:57361437-57361459 CAAAAAATAAAAATGAAGGCCGG - Intergenic
925478585 2:4245888-4245910 ACTAACATAAAGATGAAGGAGGG + Intergenic
925701258 2:6640645-6640667 CTGAAAATATAGATGAACTCAGG - Intergenic
926888404 2:17618355-17618377 CAGAATTTAAAGATGGAGGAGGG - Intronic
927560716 2:24070930-24070952 CTGAATATAAGCTTGAAGGAAGG - Intronic
927662208 2:25002616-25002638 CAGAAATTTAAGATGAAAGATGG + Intergenic
928115494 2:28542889-28542911 CTGAGTAGAAGGATGAAGGAAGG - Intronic
928265603 2:29808896-29808918 CTGTACATAAAGATGAATAATGG - Intronic
928275663 2:29898008-29898030 GTGAAAATGAAGTTGGAGGATGG + Intronic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928840645 2:35600324-35600346 TTGTAAATAAAGATGGGGGAGGG + Intergenic
929096711 2:38269361-38269383 CAGAAATTAAAAATGATGGAAGG + Intergenic
929105963 2:38366219-38366241 CTCAAAAACAGGATGAAGGAAGG + Intronic
929560924 2:42955873-42955895 ATGTAGACAAAGATGAAGGAGGG - Intergenic
930129408 2:47833961-47833983 TTGAAAATAAAGATGCAGCCAGG - Intronic
930136471 2:47906958-47906980 CTGAAAAAAAAGTGGAACGAGGG + Intergenic
931244558 2:60481312-60481334 TTGAAAACAAAAATGAAGCAGGG + Intronic
931364256 2:61605200-61605222 CTGAGAACAAAGGTGAAAGAAGG - Intergenic
931774569 2:65529600-65529622 CTGTACAGAAAGATAAAGGAGGG - Intergenic
932029215 2:68165950-68165972 CTGACCATAAAGATGCACGAGGG - Intronic
933024932 2:77244532-77244554 CTGAAAATAGAGATTATGGAAGG + Intronic
933161126 2:79026305-79026327 CTGCAAGTTAACATGAAGGAAGG - Intronic
933260456 2:80126168-80126190 CTGAAAAGAAAAATGAGGCAAGG + Intronic
933384845 2:81597100-81597122 CTAAAAATCAAGATGCAGGCAGG - Intergenic
933483727 2:82891451-82891473 CTGAAAATAAAAATAAATAAGGG - Intergenic
935100920 2:99995253-99995275 CTGAAATTATAGAAAAAGGATGG + Intronic
935539023 2:104327406-104327428 CAGAAAATAAAAATCAAGTATGG + Intergenic
935634524 2:105239840-105239862 CAGAAAATTGAGATGAAGAAGGG + Intergenic
936273940 2:111075434-111075456 CTGAAATCAAAAATGAAAGAAGG - Intronic
936860709 2:117015695-117015717 CTCAAAATAAAGATATATGATGG - Intergenic
936952165 2:117988767-117988789 CTGAAAGAAATGATGAAAGATGG + Intronic
937471569 2:122178293-122178315 CTGAAAAGAAAGATGGTGAAAGG - Intergenic
937471576 2:122178350-122178372 CTGAAAAGAAAGATGGTGAAGGG - Intergenic
937628493 2:124070583-124070605 CTGAAAATAGAGACAAAGAAGGG + Intronic
937688945 2:124732256-124732278 CTGAAAAGAAACAAGAAGTATGG - Intronic
937703205 2:124887647-124887669 CTGAAAATGAGGATGAAAGAAGG + Intronic
938211709 2:129471154-129471176 CATAAAATAAAAATAAAGGAAGG + Intergenic
939178944 2:138781795-138781817 CCCAAAATAGAAATGAAGGAGGG + Intergenic
939417084 2:141913745-141913767 CTTAAAAAAAAAATGTAGGAGGG - Intronic
939458624 2:142469676-142469698 CACAAAATAAAAATGAAAGAAGG + Intergenic
939519761 2:143215177-143215199 CTGAAAATGGAGATTCAGGATGG + Intronic
939729506 2:145764680-145764702 CTGTAAGAGAAGATGAAGGAGGG - Intergenic
939827751 2:147035395-147035417 CTCAAAAAAAAAAGGAAGGAAGG + Intergenic
939892117 2:147748827-147748849 TTAAAATAAAAGATGAAGGAAGG + Intergenic
940029003 2:149240794-149240816 CTGAGAACAAAGCTGTAGGAGGG - Intergenic
940071596 2:149694464-149694486 CTAAATATAGAGGTGAAGGAAGG + Intergenic
940742955 2:157532821-157532843 CAGAAAAGGAAGAGGAAGGAAGG - Exonic
940900981 2:159125968-159125990 CTGGCATTGAAGATGAAGGAAGG - Intronic
941515519 2:166471111-166471133 ATGAGAATAAAGATGAAGAGAGG + Intronic
941572467 2:167188994-167189016 CTCAAATTAAAGCTGAAGAAAGG - Intronic
941577750 2:167255686-167255708 CTGAAAACTAAGATGAAATAAGG - Intronic
941588913 2:167394055-167394077 CTAAAATTAAATATGAAGAATGG - Intergenic
942013750 2:171790343-171790365 CTGAAAAGACAAAGGAAGGAAGG - Intronic
942475963 2:176321130-176321152 CTGAAAACAAGGAAGAAGGGAGG - Intronic
942818483 2:180081331-180081353 AGGAAAATACAGATGCAGGAGGG - Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943133382 2:183885198-183885220 CAGAAAATAAATCTGATGGAAGG + Intergenic
943342552 2:186697970-186697992 GTGAAAATAAAGACTAAGGTTGG + Intronic
943395263 2:187325619-187325641 CAGAACACAAAGACGAAGGATGG - Intergenic
943529388 2:189060064-189060086 ATGATGATAATGATGAAGGAGGG - Intronic
943686227 2:190821218-190821240 CTGAAATGAAAGAGGAAGGAAGG - Intergenic
943936945 2:193931433-193931455 ATGAAAATATAGATGAATAAGGG + Intergenic
944640795 2:201723473-201723495 CTGAAGATAAGGATAAAGTAGGG + Intronic
945450165 2:209985088-209985110 CTGAAGCTGAAAATGAAGGAGGG - Intronic
945506192 2:210643534-210643556 TTTAAAATAAAGATAAAGCACGG - Intronic
945925677 2:215801242-215801264 CTAAAATTAAAAATGAAGCAGGG + Intergenic
946018091 2:216620315-216620337 CTAAAAGTAAACATGAAGGTCGG + Intergenic
946069732 2:217023678-217023700 TAGAACAAAAAGATGAAGGAAGG - Intergenic
946706837 2:222466552-222466574 CTGAAAATAAAAATTAAGGCTGG - Intronic
946815951 2:223578615-223578637 CTAAAAATAAAAATAAAAGAGGG + Intergenic
947349598 2:229229324-229229346 GTGAAAATAAACATGATGCATGG - Intronic
947354874 2:229281685-229281707 CTGAAAATAGATTTGAATGATGG - Intergenic
947675462 2:231975399-231975421 GTTAAAAAAAAGATGAGGGATGG + Intronic
947787955 2:232841609-232841631 ATGAAAATACAAATGAAGGCAGG - Intronic
948254817 2:236558740-236558762 TTCAAAATAAAAAGGAAGGAAGG + Intergenic
948594717 2:239072559-239072581 CTGAAAATCCATATGAAGGGAGG - Intronic
1169732094 20:8797487-8797509 CAGTAAAGAAAGACGAAGGATGG - Intronic
1169884789 20:10387223-10387245 CTGAAAATGATGAAGATGGATGG + Intergenic
1170281661 20:14655959-14655981 CTGGAAATAGAAATGAAGAAAGG + Intronic
1170448881 20:16460670-16460692 ATCAAAATGAAGATGAAGAATGG + Intronic
1170452733 20:16501866-16501888 CTGAAAAGAAGGATTAAGGGGGG + Intronic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1171987139 20:31668301-31668323 CTGAGAAGAAAAATCAAGGAAGG - Intronic
1172601064 20:36183284-36183306 ATCAACATGAAGATGAAGGAGGG - Intronic
1172610862 20:36251518-36251540 CTAAAAATAAATATCAGGGATGG + Intronic
1172942232 20:38662069-38662091 CTGAAATAAAAGTTGAAGGCTGG + Intergenic
1173097142 20:40045557-40045579 AAGTAAATAAAGCTGAAGGAGGG - Intergenic
1173409690 20:42799119-42799141 ATGAAAACTAAGATGAAGAAAGG + Intronic
1173990981 20:47303271-47303293 CTGAAAAAAAAGAAAAAGAAGGG - Intronic
1174433538 20:50488983-50489005 CTGGCTTTAAAGATGAAGGATGG - Intergenic
1174980199 20:55385467-55385489 GTAAAAATAAAAAAGAAGGAAGG + Intergenic
1175432467 20:58915657-58915679 CTAAAAAGACAGAAGAAGGAAGG - Intergenic
1175474204 20:59258175-59258197 TTAAAAAAAAAGATGGAGGAGGG + Exonic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176387209 21:6144385-6144407 CTCAAAAAAAAAAGGAAGGAAGG - Intergenic
1177254369 21:18641064-18641086 CTGAAAATAAACTTGAAAGATGG - Intergenic
1177427996 21:20950376-20950398 CTAAGAATAAAGATCAAAGATGG - Intergenic
1177560986 21:22753509-22753531 CTGAAATTAAAGATGATGTTTGG - Intergenic
1177726563 21:24975750-24975772 TTGAAAATAAAGAACAAGGTAGG + Intergenic
1177931331 21:27287730-27287752 CTAAAAACAAAGAAGAAGGGAGG + Intergenic
1178332826 21:31714593-31714615 GTGAAGATAAAGAAGAACGAGGG + Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178481387 21:32982426-32982448 CTGAGAAGAAAAATAAAGGAGGG + Intergenic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1179100635 21:38352890-38352912 CTGAAACTACAGTTGAAAGAAGG - Intergenic
1179736264 21:43393863-43393885 CTCAAAAAAAAAAGGAAGGAAGG + Intergenic
1180716877 22:17877837-17877859 CTCAAAAAAAAGAAGAAGGGAGG - Intronic
1181685153 22:24523081-24523103 CTGCAAATAGAGATGCAGAAAGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1181929127 22:26385321-26385343 CTGACAATCAAGATGAGTGATGG + Intergenic
1182175780 22:28286726-28286748 CTGAATATCTAGATCAAGGAAGG + Intronic
1182210230 22:28670085-28670107 CTGAAAATAAAAATGGGGGGGGG + Intronic
1182648738 22:31832982-31833004 CTGAGAAGAAAGCTGGAGGAAGG - Intronic
1182807888 22:33090993-33091015 TTAGAAATAAAGATGATGGATGG - Intergenic
1183131863 22:35844804-35844826 CTGAAAATAAAACTGAAGTAAGG - Intronic
1183214939 22:36473533-36473555 CAGAAAGAAAAGAGGAAGGAAGG + Intronic
1183347549 22:37316210-37316232 CTCAAAATAAAAAGAAAGGAAGG + Intergenic
1183816851 22:40309251-40309273 CTGAAACAAAGGCTGAAGGAAGG - Intronic
1184060468 22:42078247-42078269 CAGGAAATAAAGAGGATGGAAGG - Exonic
1184878617 22:47291130-47291152 CTCAAATGAAAGATGAAGGCTGG + Intergenic
949107907 3:222890-222912 CTGGCTATAAAAATGAAGGATGG - Intronic
949141283 3:636366-636388 CTAAAAATGAAGAGGAAGGTGGG + Intergenic
949159702 3:865973-865995 CTGAAAATAAAACTGCAAGAGGG + Intergenic
949709499 3:6858500-6858522 CTGAAATTAAAAATGAAATAAGG + Intronic
949897002 3:8775299-8775321 ATGAAAATCAAGTTGAAGGAGGG + Intronic
950311248 3:11959974-11959996 GGGAAAGTAAAGATAAAGGATGG + Intergenic
950705366 3:14776218-14776240 CTGAAACACAAGAGGAAGGAGGG + Intergenic
950816948 3:15714729-15714751 ATAAAAATAAAGATGCAAGAGGG - Intronic
950928612 3:16767351-16767373 GTGAAAATTAAAATTAAGGAAGG + Intergenic
951313296 3:21157312-21157334 CTGACATTGAAGATGGAGGAAGG - Intergenic
951313370 3:21158227-21158249 CAGAAAGTAAACCTGAAGGAAGG + Intergenic
951677886 3:25262578-25262600 CTGGACTTGAAGATGAAGGAAGG - Intronic
951744346 3:25960823-25960845 GAGAAAAAAATGATGAAGGAGGG + Intergenic
952275690 3:31873689-31873711 CTGAGAATAAAGAAGAAACACGG + Intronic
952433297 3:33247125-33247147 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
952558354 3:34559677-34559699 ATGAAAAAAAATAGGAAGGAAGG - Intergenic
952820261 3:37480440-37480462 CTGAGGAGAAAGCTGAAGGAAGG - Intronic
953987442 3:47455839-47455861 TGGAAAATAAAGATGATGAAAGG + Intronic
954513010 3:51144462-51144484 CAGAAGAAAAATATGAAGGATGG - Intronic
955278643 3:57572727-57572749 CTGAAAAGAAAGCTGAATGAGGG - Intronic
956142714 3:66161900-66161922 TTGAAAAGAAAAATGAACGATGG + Intronic
956151640 3:66249812-66249834 TTGTATATAAAGATGAATGAAGG + Intronic
956332952 3:68131457-68131479 ATAAAAATAAGGATGCAGGAAGG - Intronic
956512759 3:70012447-70012469 CGGACTTTAAAGATGAAGGAAGG + Intergenic
956720882 3:72116612-72116634 ATGAAATTAAAGCTGAGGGATGG - Intergenic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
958534544 3:95382016-95382038 CAGATAATAAAGATCAAGGAGGG - Intergenic
958716983 3:97795706-97795728 TTGAAAATAAGGATGAACGTGGG + Intronic
959164222 3:102757143-102757165 CTGAAAAAAAAAAAGAAGCAGGG - Intergenic
959276362 3:104281938-104281960 CTGAAAAAAAAGAAAAAGAAGGG - Intergenic
960021416 3:112958462-112958484 CCGCAAATGAGGATGAAGGAAGG + Intronic
960421007 3:117445150-117445172 CTGTAAAAATAGATTAAGGATGG - Intergenic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
962347395 3:134628205-134628227 ATGGAAACAAAGATGCAGGAAGG + Intronic
962915951 3:139903795-139903817 TTGAGAGTAAAGATGAAGGGAGG - Intergenic
963179937 3:142344050-142344072 ATGAAAATAGAGTAGAAGGATGG + Intronic
963403855 3:144837852-144837874 CAGAAAAAAAAAAGGAAGGAAGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963774085 3:149420828-149420850 CTAGAAATGAGGATGAAGGATGG + Intergenic
964330207 3:155593914-155593936 CTGAAAATAAAGTTCTAGAAAGG + Intronic
964697071 3:159521123-159521145 CTGAAAATAACTAAGAAGGTGGG - Intronic
964938698 3:162127272-162127294 ATTAAAATACAGATAAAGGAGGG + Intergenic
966314370 3:178629161-178629183 CTGGAACTAAAAATGCAGGAAGG - Intronic
966458314 3:180143518-180143540 GTGAAACTTAAGATGAAGGCAGG - Intergenic
966695663 3:182788092-182788114 CTTAAAATAAGGAAGAAGGAAGG + Intergenic
967532009 3:190559234-190559256 CTAAAAATAGAAATGAATGATGG - Intronic
967684511 3:192404465-192404487 CTCAAAATAAAGCTAAAGGTTGG + Intronic
967899994 3:194440121-194440143 CAGAAAACAAACCTGAAGGAAGG + Intronic
968212054 3:196856961-196856983 AAGAAAAGAAAGAGGAAGGAAGG + Intergenic
970043159 4:11819787-11819809 GTGAGAATAAAGATGAAGCTTGG + Intergenic
970554560 4:17218122-17218144 CTGGCTTTAAAGATGAAGGATGG - Intergenic
971194404 4:24458103-24458125 CAAAAACTAAAGATGAAGGAAGG + Intergenic
971629712 4:28974731-28974753 CAGAAGAAAAAGGTGAAGGAAGG - Intergenic
971989477 4:33872742-33872764 GAGAAAATAAAAAGGAAGGAAGG - Intergenic
972165428 4:36277856-36277878 CTGAAAGTAAAGATGAACTTAGG - Intergenic
972850076 4:43037756-43037778 CTTAAAAAAAAGATTAAGGGAGG + Intergenic
972970013 4:44562770-44562792 ATGAAATGAAAGATGAAGAAAGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974095870 4:57363270-57363292 CGGAAAATGAAGATGAGGGCAGG - Intergenic
974474951 4:62366488-62366510 CACAAAAGAAAGATGAAGGTCGG - Intergenic
974809799 4:66931359-66931381 GTGACAATAAAGATGATGGAGGG - Intergenic
974972854 4:68851764-68851786 CTGAGAACAAAGTTGAAGCAGGG - Intergenic
975018459 4:69455685-69455707 CTGAGAACAAAGTTGAAGCAGGG - Intergenic
975072440 4:70158588-70158610 CTGAAAAAAACCTTGAAGGAGGG - Exonic
975642624 4:76515383-76515405 CTGAAAAAAAAAAGGAAGGAAGG + Intronic
975645222 4:76539254-76539276 ATTAACATAAAGGTGAAGGAAGG - Intronic
975694698 4:77000405-77000427 CAGAAAATAAAGGTGAAGCCAGG + Intronic
975838763 4:78452450-78452472 CAGAAAATAAATATGAATTAAGG - Intronic
975858276 4:78648352-78648374 CAGAAAAGAAAGATGAAAGAAGG - Intergenic
976022976 4:80653086-80653108 CTGAGAAAAGAGATGTAGGATGG - Intronic
976108301 4:81643097-81643119 CTGAAAATCAAATTGAAGCATGG + Intronic
976680307 4:87747848-87747870 CTGAGAGTGAAGATCAAGGAGGG + Intergenic
977009648 4:91621316-91621338 ATGAAAGGAAAGGTGAAGGAAGG + Intergenic
977017986 4:91718144-91718166 GAGAAAATAAAGAGAAAGGAAGG + Intergenic
977145589 4:93435947-93435969 CTGAAAATAAAAGAGAAGTAGGG - Intronic
977287018 4:95120658-95120680 AAGAAAAGAAAGAAGAAGGAAGG - Intronic
977316317 4:95453040-95453062 CGGAAAATATACAGGAAGGAAGG + Intronic
977661055 4:99586733-99586755 CTTAAAATAAATATAAAGGAAGG + Intronic
978130567 4:105191198-105191220 CTGAAAATACAAAAGAAAGAGGG + Intronic
978293687 4:107177079-107177101 ATGGAAATAGAGATGAAAGATGG - Intronic
978399005 4:108311590-108311612 ATGAAAATGGAGATGAGGGATGG - Intergenic
978613110 4:110566142-110566164 TAGAGAATAAAGATCAAGGATGG - Intergenic
979144634 4:117228165-117228187 CTGAAAGTAATGATGTAGAAAGG + Intergenic
979742107 4:124164649-124164671 CTGAAAGTTAAAATGAAGAAAGG - Intergenic
980218062 4:129877013-129877035 ATGAAAATGTAGATGAGGGAAGG - Intergenic
980647608 4:135662736-135662758 CAGAAAACAAAGAAGAAGCAAGG - Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
980779430 4:137478287-137478309 CTTAAAACAGAGATTAAGGAAGG - Intergenic
980874444 4:138646986-138647008 ATGATCATAAAGATGAAGAAAGG - Intergenic
981019348 4:140008618-140008640 CTGAAAATCAATATAAAGGCAGG - Intronic
981157298 4:141453990-141454012 ATGAAAAGAGAAATGAAGGAAGG - Intergenic
981175740 4:141681240-141681262 TAGAAAAAAAAGAGGAAGGAAGG - Intronic
981721985 4:147811086-147811108 CTGAAAATGAAGAGGAAGCCAGG - Intronic
982424010 4:155235441-155235463 ATGAAAATAAAAATGAGGGTTGG - Intergenic
982799875 4:159692275-159692297 CACAAAAGAAAGATGAAGGCTGG - Intergenic
983165230 4:164468139-164468161 TTGAAAAAAGAGATGAAGGATGG + Intergenic
983268354 4:165531851-165531873 TTGAAAATATATATTAAGGATGG - Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984051739 4:174872888-174872910 CAGAACAAAAAGGTGAAGGAAGG + Intronic
984136555 4:175947943-175947965 ATGAATAAAAAGATGAATGAAGG + Intronic
984296289 4:177858616-177858638 TAGAAAATAAAGGTGAAGGCTGG + Intronic
984418699 4:179492483-179492505 AGGAAAAGAAAGAGGAAGGAAGG - Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
984791277 4:183617184-183617206 GGGAAAAGAAAGAGGAAGGAGGG - Intergenic
985729017 5:1536112-1536134 CTCAATATAAAGAAGAAAGAGGG - Intergenic
986206358 5:5628631-5628653 TTGAAAATAATCCTGAAGGATGG - Intergenic
986559163 5:9043619-9043641 ATTAAAATGAAGATGAAGGAGGG + Intronic
987176141 5:15312535-15312557 CTGAAAAGAAAGACGTTGGAAGG + Intergenic
987455911 5:18146401-18146423 ATGAAAATAATGATGAAGTAGGG + Intergenic
987508486 5:18803567-18803589 GTGAGAAAAAATATGAAGGAAGG + Intergenic
988214622 5:28255271-28255293 CTGAAATTAAAGGTGAATGTAGG - Intergenic
988256033 5:28821355-28821377 TTCAAAATAAAAATGATGGATGG + Intergenic
988268773 5:28986889-28986911 CTGGAAAAAATGATGAAAGAAGG - Intergenic
988997026 5:36724620-36724642 TTGAAAATAAGGAAGAGGGAGGG + Intergenic
989022348 5:37023462-37023484 CAGAAAGTACAGATGAAGTATGG - Intronic
989299765 5:39876976-39876998 CAGAGAAAAAAGAGGAAGGAGGG + Intergenic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
990143147 5:52729053-52729075 CTGAAATGAAATATGAATGAGGG + Intergenic
991419298 5:66425164-66425186 TAGGAAATAAAGATAAAGGATGG + Intergenic
991464452 5:66895263-66895285 TTTAAAATAAAGAAGAAGGGAGG - Intronic
992767175 5:80012154-80012176 GTAAAAATAAAAATAAAGGAAGG + Intronic
992923177 5:81549255-81549277 ATGAAGAGAAAGATGAAGGCAGG - Intronic
993014498 5:82520240-82520262 GTGAGAATAAAGAAGATGGATGG + Intergenic
993284271 5:85970369-85970391 CAGTAAAAAAAGATAAAGGAGGG - Intergenic
993418793 5:87673556-87673578 GTGAAAATAAATATGAAAAAGGG - Intergenic
993613599 5:90084100-90084122 CTGAAAATCCAGATGACGGGAGG + Intergenic
993789324 5:92188202-92188224 GTTAAAATAGAGTTGAAGGAAGG + Intergenic
994261394 5:97662987-97663009 CTGGAAACAAAGATGAATGCTGG + Intergenic
994501402 5:100583187-100583209 CTGAAGAGAAGGAGGAAGGAGGG + Intronic
994520234 5:100824652-100824674 CTGAAAAAAAAGGTGGAGGGGGG + Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994704757 5:103189082-103189104 CTTGAACTAAAGATGAAGGGAGG - Intronic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
995013735 5:107287202-107287224 CAGAAAATAAGTATGAATGAAGG + Intergenic
995553702 5:113305540-113305562 CTGGAAGAGAAGATGAAGGAAGG - Intronic
995933894 5:117485282-117485304 CTGAAAATAGAGCCCAAGGAAGG + Intergenic
996123917 5:119704132-119704154 TTGAAAGTTAAGATAAAGGAAGG - Intergenic
996157215 5:120116240-120116262 CTCACAAGAAAAATGAAGGAGGG - Intergenic
996206769 5:120747745-120747767 AGGAAGAGAAAGATGAAGGAAGG + Intergenic
996313669 5:122137079-122137101 CTGAACATAACTATGATGGATGG + Intronic
996361195 5:122649109-122649131 CAGAAAATAAAGAAGAAATATGG - Intergenic
996634580 5:125674481-125674503 CTAAAAGTAAAGATAAAAGATGG - Intergenic
996668048 5:126083766-126083788 CTGAAAATCCAGATCATGGAAGG + Intergenic
996673425 5:126147258-126147280 CAGTAAATACTGATGAAGGAAGG + Intergenic
996883518 5:128328019-128328041 ATGAAAATATAAATGAAGAAAGG - Intronic
996944153 5:129046548-129046570 TAGAAAAAAAAGATGAAGGAAGG - Intergenic
997130605 5:131272403-131272425 CTGAAAATGAAGAGGAAAAAAGG - Intronic
997219132 5:132144560-132144582 ATGAAAATAGAGATGACAGAGGG + Intergenic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997286580 5:132683634-132683656 CTAAAAATAAAAATGGAAGATGG + Intergenic
997334080 5:133092200-133092222 CTAAAAATAACAATGAAAGAAGG - Intronic
998592209 5:143489751-143489773 CAATAAATAAAAATGAAGGAAGG + Intergenic
998745120 5:145249651-145249673 TTTAAAATAATGTTGAAGGAAGG - Intergenic
999771864 5:154782122-154782144 CAGAAAATGAAACTGAAGGAAGG - Intronic
999916511 5:156268590-156268612 CTCAAAATAGAAAGGAAGGAAGG - Intronic
1000457500 5:161469883-161469905 GAGAAAATAGAGATGAAGAAAGG - Intronic
1000521046 5:162294745-162294767 CTGAAAATAACTATGAAGCCAGG - Intergenic
1000781097 5:165482586-165482608 CTGAAATAAAAGATAAAGAATGG + Intergenic
1000950400 5:167474911-167474933 CAGTAAATAAAAATGAAGAAAGG - Intronic
1001220459 5:169895905-169895927 CAGAAAATAGGGAAGAAGGAAGG - Intronic
1001542927 5:172551740-172551762 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
1002037005 5:176479373-176479395 CTAAAAATAAAAGTGCAGGAAGG + Intronic
1002224747 5:177711953-177711975 TTGAAACTAAAGAAGAAGAATGG - Intronic
1002625599 5:180526304-180526326 CTGAAGGTAAAGATCCAGGAGGG + Intronic
1002812395 6:643644-643666 CTCAAAGTAAAGGGGAAGGAGGG + Intronic
1003735296 6:8871708-8871730 CTGAAAATACAGGAGCAGGAAGG + Intergenic
1003737777 6:8896859-8896881 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
1003972720 6:11314419-11314441 CTAGAAATATGGATGAAGGAAGG + Intronic
1004465140 6:15878266-15878288 TTGAAAATAAACATGAAACAAGG - Intergenic
1004496889 6:16172897-16172919 CTCAAAATAAAAAAGAAAGATGG - Intergenic
1005219302 6:23567862-23567884 GTTAAATTAAAGAAGAAGGAAGG + Intergenic
1005260944 6:24058820-24058842 CTGACATTAAAAATGAATGAAGG - Intergenic
1005660263 6:27991202-27991224 TTTGAAATAAAGATGTAGGAAGG - Intergenic
1006262843 6:32891030-32891052 TTGAAAATAAAGAGGAAGTTGGG - Intergenic
1006416121 6:33904945-33904967 CTAAAAATAAATTTGAAGAAGGG - Intergenic
1006978693 6:38127864-38127886 CTGAAACCTAAGCTGAAGGAAGG - Intronic
1007455216 6:41971836-41971858 CCAAAAATAAAGAAAAAGGAAGG - Intronic
1008052475 6:46914290-46914312 CTGAAAATACAGATTTATGAAGG - Intronic
1008496508 6:52139402-52139424 CTAAAAATAAACAAGAAAGAGGG - Intergenic
1009353848 6:62715036-62715058 ATAAAAAGAAAGAAGAAGGAGGG + Intergenic
1009849538 6:69178252-69178274 CTGAACACAAAGAAGAAGCAGGG - Intronic
1010034747 6:71311850-71311872 CAGATAATGAAGGTGAAGGATGG + Intergenic
1010725387 6:79327117-79327139 CTGAAAATAAGGAAGTAGCACGG - Intergenic
1010749027 6:79597339-79597361 AAGAAAAGAAAGAGGAAGGATGG + Intergenic
1010848213 6:80738465-80738487 CTGAAAAAAAAAAAAAAGGAAGG - Intergenic
1010865581 6:80973424-80973446 CTGTCTATGAAGATGAAGGAAGG - Intergenic
1011312723 6:85998234-85998256 CAGAAAAATAAAATGAAGGAAGG + Intergenic
1012087518 6:94849340-94849362 CTGAATATAATGATGTAGGCAGG - Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013741955 6:113297833-113297855 TTGAGGATAAAGATGAGGGATGG - Intergenic
1014342073 6:120223031-120223053 CAGAAAATCAAGAGGTAGGATGG + Intergenic
1014475553 6:121868279-121868301 CTAAAAATAAAGATAAATGAAGG - Intergenic
1014713489 6:124837627-124837649 TTTAAAATAAGGATGAAGGAAGG - Intergenic
1014733915 6:125068945-125068967 GTGAAGATGAAGCTGAAGGAGGG + Intronic
1014759203 6:125337194-125337216 TTGAAAAAAAAGAGGAAGCAAGG + Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015090716 6:129354372-129354394 CTGAAAATAAATGTGAAGGTAGG + Intronic
1015285499 6:131482148-131482170 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1015370853 6:132450822-132450844 CTCAAAAGAAAGAAGAAAGAAGG + Exonic
1015464542 6:133534026-133534048 ATGGAAATAAAGAACAAGGATGG + Intergenic
1016635320 6:146282479-146282501 ATGAAAGAAAAGATGAAGGAAGG + Intronic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1017530156 6:155281896-155281918 CTGAAAAAAAAGATTAAGCGTGG + Intronic
1017545650 6:155448713-155448735 CTGAAAAATAAAATGAAAGAAGG - Intronic
1017815392 6:158012456-158012478 CTGAATTTGAAGAGGAAGGAAGG + Intronic
1017957133 6:159188094-159188116 CTTCAAACAAAGATGAAGTAGGG + Intronic
1018148640 6:160918146-160918168 AAGAAAAGAAAGATGAAGAAAGG + Intergenic
1019027789 6:168985736-168985758 AAGTAAATAAATATGAAGGAAGG + Intergenic
1019809184 7:3152126-3152148 ATGATAATAAAAAGGAAGGAGGG - Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020235127 7:6349129-6349151 CTGAAAATGAAGACAAAGGGAGG + Intergenic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020478122 7:8623158-8623180 CTGAATTTAATGATGCAGGAGGG + Intronic
1020484774 7:8707884-8707906 ATGAAAATAAAGAATAAGAAAGG - Intronic
1020727090 7:11829640-11829662 ATGAAAATAAAGAGGCAAGAAGG - Intronic
1020772556 7:12413392-12413414 CTGGTTTTAAAGATGAAGGAAGG - Intergenic
1020799665 7:12718113-12718135 CTCAAAAAAAAGAAGAAGGAAGG - Intergenic
1020995093 7:15253381-15253403 CTAAAAATGAAGATGAAGGGAGG + Intronic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021345601 7:19524448-19524470 CTGAAAATGAAGAAGCAGAAAGG + Intergenic
1021620289 7:22544532-22544554 CTGACCCTGAAGATGAAGGAAGG - Intronic
1021883299 7:25114320-25114342 CTCAAAATAAGAATGAAGGAGGG - Intergenic
1021940294 7:25672444-25672466 CAGAAAAAAAAGATAAAGAAAGG - Intergenic
1022718585 7:32921893-32921915 CTGAAAGTAAAGTTGCAGTAGGG - Intergenic
1022922186 7:35026757-35026779 CTGAAAATAATGATTAAGAAAGG + Intronic
1023104844 7:36753434-36753456 CTGAAAATAACTATAAAAGATGG - Intergenic
1023124837 7:36945388-36945410 CAGAAAATAAACATTAGGGAGGG + Intronic
1023384059 7:39637322-39637344 CTGATAATAAAGATCAAACAAGG - Intronic
1024186969 7:46959185-46959207 GAGTAAGTAAAGATGAAGGAGGG - Intergenic
1024596579 7:50942867-50942889 CTAATAATAAAGTTGAAGGAAGG + Intergenic
1024718730 7:52110232-52110254 CTGAAGGGAAAGATGAAGGCAGG + Intergenic
1025946265 7:66107249-66107271 ATAAAAATAAAAATGAAGGCCGG - Intronic
1026143172 7:67723508-67723530 CTGAAAATAACGCTGCCGGAAGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027645364 7:80790702-80790724 CAGAAAGTAAAGATGGAGAAGGG - Intronic
1028261499 7:88672363-88672385 CTGATAATAGAGATGAAGGAGGG + Intergenic
1028269249 7:88767725-88767747 CTGAAAATGTAGGTGAAGGCTGG - Intronic
1028381786 7:90208336-90208358 CTGAAAAAAAAGAGAAAGGAAGG + Intronic
1028973242 7:96882926-96882948 GTGAAAATAAGAAAGAAGGAAGG + Intergenic
1029635169 7:101778711-101778733 GAGAAAAGAAAGAGGAAGGAAGG - Intergenic
1029897156 7:103995215-103995237 CTGAAAACAATGGTGAAGCATGG + Intergenic
1030235994 7:107262715-107262737 CTGAGAATAAGGAGGAGGGAAGG - Intronic
1030334153 7:108306206-108306228 ATGAAATTAATGGTGAAGGATGG - Intronic
1030872952 7:114780240-114780262 CTGAATAAAAACATAAAGGAAGG + Intergenic
1031677594 7:124630605-124630627 CTGCAAATTAAGATGACAGATGG + Intergenic
1031971590 7:128068649-128068671 CTGAAATCAAACATGGAGGAAGG - Intronic
1032517283 7:132516485-132516507 CTGAAAATAAAATTGCAGCATGG + Intronic
1032714324 7:134492008-134492030 CTGAAACTGAAGAGGAAAGAGGG - Intergenic
1032836972 7:135683605-135683627 CTGAAAATGAAAATGAATGGTGG + Intronic
1033187051 7:139237280-139237302 ATAAAAATAAAAATGAATGATGG - Intronic
1033883752 7:145918694-145918716 AAGCAAATAAAAATGAAGGATGG + Intergenic
1034340098 7:150347257-150347279 CAGAAAATAAAAAGGAGGGAGGG - Intergenic
1034829854 7:154299591-154299613 CTAAAAATAAAAATGAATGTGGG - Intronic
1035855981 8:2976904-2976926 CTGACAATAAAGCTGTAAGAGGG + Intronic
1035974339 8:4290534-4290556 GGGAAAACAAAGATGAAGAAGGG + Intronic
1036282276 8:7410742-7410764 CTGGATTTGAAGATGAAGGAAGG - Intergenic
1036339192 8:7900828-7900850 CTGGATTTGAAGATGAAGGAAGG + Intergenic
1036466940 8:9006933-9006955 CTGTAATTATAGATCAAGGAAGG - Intronic
1036978957 8:13446940-13446962 CTCAAAAAAAAAAAGAAGGAAGG + Intronic
1038047248 8:23775893-23775915 CTCAAAATAAGGATGGAGGTGGG + Intergenic
1038048336 8:23786327-23786349 ATTAAAAAAAAGATGAAGAAGGG + Intergenic
1038119909 8:24601588-24601610 CTGAAAACAAGGTTCAAGGAAGG - Intergenic
1038303703 8:26379958-26379980 CTGAAAATGATGAAGATGGATGG - Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1039753625 8:40499256-40499278 CTGAAAGAAAAGAGGAAGGGCGG + Intergenic
1040903562 8:52441662-52441684 CTCAAAAAAAAAAAGAAGGAAGG + Intronic
1041371649 8:57167154-57167176 CTGAAAGAAAAAATGAGGGAGGG - Intergenic
1041455955 8:58060388-58060410 CTGAAAAGAAATATGTATGAAGG + Intronic
1041812537 8:61927646-61927668 CTCAAAATAAAAATGTAGGATGG - Intergenic
1041935140 8:63324931-63324953 CTGAAGCTAAATAGGAAGGATGG - Intergenic
1042053404 8:64735571-64735593 ATGAAAATAAATCTCAAGGAAGG - Intronic
1042086869 8:65119099-65119121 CTGAAGGTAAGAATGAAGGAGGG + Intergenic
1042114633 8:65417285-65417307 GTAAAAATAAATATGAAGGCAGG + Intergenic
1042444791 8:68871347-68871369 CAGAAAACAAAGATGGAGGTAGG - Intergenic
1043235285 8:77857347-77857369 TTGAAAATAAAGATAAACAAAGG + Intergenic
1043779264 8:84311717-84311739 CTGAAAATGAAGAGTAATGAAGG + Intronic
1044331321 8:90923133-90923155 CTGAAAATGAGGGTGAAGGTAGG + Intronic
1044541941 8:93418181-93418203 CTAAAAATATAAATGTAGGAAGG - Intergenic
1044888919 8:96811354-96811376 CTAAAAATAATGATGAACGGAGG - Intronic
1044992935 8:97812501-97812523 TTGAAAATAAACATTTAGGACGG - Intronic
1045067930 8:98468812-98468834 CAGAAAATAAAGATGAGAGCCGG + Intronic
1045404417 8:101851528-101851550 CTGAAAATTAAAATAAATGATGG + Intronic
1045405106 8:101858365-101858387 CTGAAAATAAAGGTGAGAGGTGG + Intronic
1045662845 8:104455843-104455865 TTGAAAATAAAATTGAAGTAGGG - Intronic
1046196778 8:110874349-110874371 TTGAAAATAAAGATAAAATAAGG - Intergenic
1046480228 8:114807563-114807585 ATGAAAATAAAACTGAAAGATGG - Intergenic
1046503081 8:115103844-115103866 CTGAAAGTAAATATTGAGGAAGG - Intergenic
1046572362 8:115982432-115982454 CTGATAATAAAGTTTAAAGATGG + Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046735345 8:117770507-117770529 AAGAAAGCAAAGATGAAGGAAGG - Intergenic
1047192812 8:122693676-122693698 CTGAACATAGAGAGGCAGGAAGG + Intergenic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1047640495 8:126814950-126814972 CTGAACAAAATGATGAAGCAAGG - Intergenic
1047794736 8:128242932-128242954 CTGAAAGGAAGGAAGAAGGAAGG - Intergenic
1047881146 8:129194979-129195001 CTAAAAAGAGAGAAGAAGGAAGG - Intergenic
1048709758 8:137195962-137195984 CAGCAAATAAAAATGTAGGATGG - Intergenic
1049012898 8:139899455-139899477 GTGAAGATAAGGATGAAGGATGG - Intronic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050290729 9:4151663-4151685 CTTAGAACAAAGATGAAGAAAGG - Intronic
1050718722 9:8560896-8560918 GTGTAAATAAAGATGCAGAAAGG + Intronic
1051010652 9:12409416-12409438 ATGATATTAAAGATGAATGAAGG - Intergenic
1051025903 9:12610527-12610549 CTCAAAGTAAAGGTGATGGAGGG + Intergenic
1051030153 9:12664937-12664959 ATGAACATAAAGTAGAAGGATGG + Intergenic
1051528775 9:18076975-18076997 CGGAAGATAAAGAAAAAGGAAGG + Intergenic
1051930857 9:22383677-22383699 CAGAGAATGAAGATGAAGAAAGG + Intergenic
1052178114 9:25489773-25489795 CTAAAAATAAAGATCACCGAAGG - Intergenic
1054759389 9:68991115-68991137 GGAAAAATAAAGATGAATGATGG - Intronic
1054989223 9:71302780-71302802 CTAAAAAAAAAAAGGAAGGAAGG + Intronic
1055013136 9:71589189-71589211 CTGAAAAACAAAATAAAGGAAGG - Intergenic
1055166239 9:73198435-73198457 TTGAAAATAGTGATGAAAGAAGG - Intergenic
1055314513 9:75020560-75020582 TTGAAAATGAAAATGAAGGCTGG - Intronic
1055398793 9:75901036-75901058 CTCAGACTAAAGAGGAAGGAAGG + Intronic
1055483187 9:76730599-76730621 CTGAAATAAAAGATGAAAGAGGG + Intronic
1056097482 9:83270300-83270322 CTGAAACCAAAGAAGAAGAATGG + Intronic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1057869144 9:98705771-98705793 CAGGAAATAAAAATGAAGGAAGG + Intronic
1057918654 9:99077617-99077639 ATGAAATAAAAGATGAGGGAAGG + Intergenic
1058038230 9:100276509-100276531 CTCAAAAAAAAGAAGAACGAGGG - Intronic
1058205426 9:102100093-102100115 CTGTCAATAAAGATGATGGCTGG + Intergenic
1058476754 9:105342508-105342530 CTGAGATGAAAGCTGAAGGAGGG - Intronic
1058716034 9:107722716-107722738 CTGAAAATATAGCTGAATTATGG - Intergenic
1059011231 9:110463567-110463589 GAGAAAATAAAGAAAAAGGAAGG + Intronic
1060015638 9:120084112-120084134 TAGAAAATAAATAAGAAGGAAGG + Intergenic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1060844925 9:126828477-126828499 TTGAAAATAAAAATGAAGGCTGG - Intronic
1062155191 9:135044209-135044231 ATGAAAATTAAGATCAAGGGAGG - Intergenic
1062585639 9:137248242-137248264 CTAACCATAAAAATGAAGGAAGG + Intergenic
1185593066 X:1291427-1291449 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1185632114 X:1522770-1522792 CTAAAAATAAAAATTAAGGCCGG + Intronic
1185933727 X:4232239-4232261 CTGTACATAAAGATGAAGAATGG - Intergenic
1186136384 X:6526261-6526283 CAAAAAACAAAGAAGAAGGAAGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186829646 X:13377944-13377966 CTGAGAATAAAGAAGAATAAAGG - Intergenic
1186976438 X:14911535-14911557 GTAAAAAGAAAGAGGAAGGATGG + Intronic
1187452671 X:19412585-19412607 CTGAAGAGAAAGAGGAAGGGAGG + Intronic
1187472616 X:19582445-19582467 CTGAAGATACCGAGGAAGGAGGG - Intronic
1188397056 X:29698041-29698063 GTGAAAGTAAAGATGAGGGGAGG - Intronic
1188429638 X:30091963-30091985 CTCAAAATAACTATGAAGTATGG + Intergenic
1188896277 X:35672278-35672300 AAGAAGATAAAGAAGAAGGAAGG - Intergenic
1189162418 X:38823361-38823383 CTGAAGATAAAGATGTAAAAGGG + Intergenic
1189378734 X:40486281-40486303 CTGAAGAAAAAGAGGAAAGAAGG - Intergenic
1190429951 X:50369560-50369582 CTTGAAAGAAAGAGGAAGGAGGG - Intronic
1190711580 X:53075369-53075391 CTAAGAATAAACATAAAGGAGGG - Intronic
1191870883 X:65743841-65743863 CCGATATTAAAGATGGAGGAAGG + Intergenic
1192860873 X:75069137-75069159 CTGAAATTGGAGATGAAGAAAGG + Intronic
1192970979 X:76229673-76229695 CTGAAAAAAAAAATAAATGAGGG - Intergenic
1193083631 X:77428778-77428800 CTGAGAATAAAGAAGTAAGAAGG + Intergenic
1193873471 X:86831078-86831100 CCAAAAATAAAGATGTAGTAAGG - Intronic
1194363776 X:92988654-92988676 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1194618157 X:96133329-96133351 GTGAAAAGAAAGAGGAAGGAAGG - Intergenic
1194877711 X:99209469-99209491 CAAAAATTAAAGATGAAGAAAGG - Intergenic
1195112686 X:101663728-101663750 CTGGAAATGAAGATGAGGGAGGG - Intergenic
1195824030 X:108977796-108977818 CTGAAGATAGAGTAGAAGGATGG + Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1196963769 X:121032750-121032772 CTGAATTTGAAGATGAAGGACGG - Intergenic
1197584752 X:128331722-128331744 AGGAAAAAAAAGATGAAGAATGG - Intergenic
1197615904 X:128691292-128691314 CTGAAAAAAAATATGATGAATGG + Intergenic
1198279457 X:135127318-135127340 ATGTTAATAAAGATGAAGAAGGG + Intergenic
1198291499 X:135245196-135245218 ATGTTAATAAAGATGAAGAAGGG - Intergenic
1198426402 X:136525065-136525087 ATGAAAATAGAGATGTGGGAGGG + Intergenic
1198778642 X:140209040-140209062 ATGACAATAAAAAGGAAGGATGG + Intergenic
1199067654 X:143439429-143439451 TTAAAAATAAAAAGGAAGGAAGG - Intergenic
1199189682 X:144955578-144955600 AGAAAAATAAAAATGAAGGAAGG + Intergenic
1199415076 X:147573136-147573158 CAGAAAATAGAGAGGAAGGGCGG + Intergenic
1199582317 X:149372746-149372768 CTGAAAATATAGCTGGAGGCTGG + Intergenic
1199608064 X:149592479-149592501 CTGCAAAGAAAGAAAAAGGATGG + Intergenic
1199631056 X:149776881-149776903 CTGCAAAGAAAGAAAAAGGATGG - Intergenic
1199924735 X:152450648-152450670 CTGGAAATAAGAAAGAAGGAGGG - Intronic
1200085482 X:153602296-153602318 TTGAATAGAAAGATGAAGGGTGG - Intergenic
1200113775 X:153759992-153760014 CAGAAAATAAAAAACAAGGAAGG + Intergenic
1200672008 Y:6104893-6104915 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1200880148 Y:8204036-8204058 CTGAAAAAGAAGGTGAAGAAAGG - Intergenic
1201259195 Y:12141295-12141317 AAGAAAATACAGATTAAGGATGG + Intergenic
1201633123 Y:16092216-16092238 ATGGAAAGAAAAATGAAGGAAGG + Intergenic
1202332211 Y:23766687-23766709 ATGAAAATATAGATGAAAGACGG + Intergenic
1202538558 Y:25903376-25903398 ATGAAAATATAGATGAAAGACGG - Intergenic