ID: 911437287

View in Genome Browser
Species Human (GRCh38)
Location 1:97877255-97877277
Sequence GATGGTGACCAGTGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911437281_911437287 -10 Left 911437281 1:97877242-97877264 CCAAAGTCCCCATGATGGTGACC 0: 1
1: 0
2: 1
3: 17
4: 113
Right 911437287 1:97877255-97877277 GATGGTGACCAGTGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911437287 Original CRISPR GATGGTGACCAGTGGGAAGA TGG Intronic
No off target data available for this crispr