ID: 911438127

View in Genome Browser
Species Human (GRCh38)
Location 1:97888696-97888718
Sequence CAGAGAGACCAGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 560}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911438127 Original CRISPR CAGAGAGACCAGAGAGAAGT GGG Intronic
900530627 1:3151274-3151296 CCCAGAGTCCAGACAGAAGTGGG + Intronic
900628833 1:3623204-3623226 CAGAGATTCCAGAGAGAGGGAGG - Intergenic
901335972 1:8449377-8449399 GAGACAGAACAGGGAGAAGTTGG - Intronic
901749765 1:11398697-11398719 CAGGGAGACCAGAGATACTTTGG - Intergenic
902476540 1:16691505-16691527 CAGAGAGATCAGAGCTGAGTGGG + Intergenic
902711234 1:18241386-18241408 CAGAGAGCCTTGAGAGAAGGAGG + Intronic
902801466 1:18832720-18832742 GAGAGAGATGAGAGAGAAGAAGG - Intergenic
902832132 1:19022313-19022335 AGGAGAGAAAAGAGAGAAGTGGG + Intergenic
904197571 1:28797193-28797215 GAGAGAGACAGGAGAGAAGCGGG - Intergenic
904724514 1:32536979-32537001 GAGAGAGACAAGAGATAAGATGG - Intronic
905176393 1:36138343-36138365 CAGACAGAGGACAGAGAAGTGGG - Intronic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905750402 1:40457588-40457610 CAGAGAGACTAATGAGAAGATGG - Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906102359 1:43271708-43271730 CAGAAAGACCAGTGAGGAGGTGG + Intronic
906125034 1:43422548-43422570 CAGAGAGGTCAGGGAGGAGTGGG - Exonic
906391846 1:45424289-45424311 CAGAGAGGCCAGGCAGAAGAGGG + Intronic
907097304 1:51793422-51793444 CAGAGGCTCCAGAGAGAAGCAGG + Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907304013 1:53503831-53503853 GAGACAGAGCAGAGACAAGTAGG - Intergenic
907459384 1:54596274-54596296 CAGAGAGACCACAGACAGGGTGG - Intronic
907513303 1:54978337-54978359 CAGAGAGGCCAGTGAGAGGCAGG + Intergenic
907563560 1:55413365-55413387 GAAAGAGAGCAGAGAGAGGTAGG - Intergenic
907834578 1:58096993-58097015 CAGAAAGACCACACTGAAGTGGG + Intronic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
910071992 1:83227724-83227746 GAGAGAGATGAGAGAGCAGTTGG - Intergenic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
912794878 1:112686936-112686958 CAGGGAGACCAGTTAGAAGAAGG - Intronic
912863536 1:113236611-113236633 GAGAGAGGCCAGAGGGATGTGGG - Intergenic
913088514 1:115460204-115460226 CAGAGATGCCAGAAGGAAGTGGG - Intergenic
914858394 1:151368391-151368413 CAGAGTCAGCAGATAGAAGTAGG - Intronic
915444691 1:155967923-155967945 CAGAGGGGGCAGACAGAAGTGGG + Intronic
915495077 1:156276549-156276571 CAGAGAGAGCAGAGAGAGCTGGG + Intronic
915496628 1:156286441-156286463 CAAAGAGACCAGTGAGCAGAGGG - Exonic
915910418 1:159911667-159911689 CAGAGAGATCAGGGAGACTTGGG + Intergenic
916683285 1:167123258-167123280 CAGAGGGACAAGAGAGAGGCTGG - Intronic
918125546 1:181580440-181580462 CAGAGAGGCCAGGGAGGAGAGGG + Intronic
918516838 1:185372671-185372693 CAGAAAGACCACAAAGTAGTTGG - Intergenic
918893407 1:190306767-190306789 TAAAGAGACCAGGGAAAAGTGGG + Intronic
920059089 1:203215274-203215296 CAGGGAGGCCAGATAGAAGGTGG + Intronic
920190078 1:204188200-204188222 CAGAGACCCCAGGAAGAAGTAGG + Intergenic
920202041 1:204265671-204265693 CAGAGGCACCAGAGAGCAGAAGG - Intronic
920415877 1:205799123-205799145 CAGAAAGCCCTGAGAGCAGTGGG + Intronic
921030404 1:211331045-211331067 CAGAGAGAACAGAGAGAAAGAGG - Intronic
921276548 1:213526254-213526276 CAGAGAGTCCAGAGGGTTGTTGG + Intergenic
922059330 1:222072766-222072788 CAGATATACCAGAGAGAAGCTGG - Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922860408 1:228811466-228811488 CAGAGAGCCCAGAGAAAGGGGGG - Intergenic
922924797 1:229339661-229339683 CAGCCAGCCCAGACAGAAGTAGG + Intronic
923779373 1:237008563-237008585 CAGTGAGACCAGAGAAAACGGGG - Intergenic
924446760 1:244140066-244140088 CAGAGAGAGCGGAGAGACCTTGG - Intergenic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
924750927 1:246888906-246888928 CAGAGAGAGAGGAGAGAATTGGG + Intronic
1062955604 10:1538459-1538481 CTGGTAGACGAGAGAGAAGTGGG + Intronic
1063949449 10:11208528-11208550 CAGAGAGGCCAGGGAGAATGCGG - Intronic
1063985911 10:11501682-11501704 CTGAGAGACCAGTGAGAAGGTGG - Intronic
1064447174 10:15406160-15406182 CACAGAAACCAGAGACAACTAGG - Intergenic
1065266209 10:23978889-23978911 CAGAGCCACCAGAGAGAACATGG - Intronic
1065886222 10:30079674-30079696 CTGAAAGACTAGAGAGCAGTGGG + Intronic
1066661106 10:37738877-37738899 CAGAGAGACCACAGAGATGCAGG + Intergenic
1066671403 10:37844166-37844188 CATAGAGACCAGAAGGCAGTGGG + Intronic
1066681727 10:37941527-37941549 CCTAGAGACCAGTGAGAATTGGG + Intergenic
1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG + Intergenic
1067768222 10:49105026-49105048 GAGAGAGACCAGAGAGACAGAGG + Intronic
1067797053 10:49328243-49328265 CACAGAGACCTCAGAGAAGAGGG - Intergenic
1068061668 10:52075831-52075853 AAGAGATACCAGAGAGCAGGTGG - Intronic
1068493331 10:57752367-57752389 CATAGAGACCAGAAGGCAGTGGG - Intergenic
1068927320 10:62553893-62553915 TAGAGACACCAGAGACAAGGAGG + Intronic
1069340349 10:67402566-67402588 CACAGAAAACAGAGAAAAGTAGG + Intronic
1069698468 10:70404819-70404841 CAGAGAGGAGAGAGAGAACTGGG - Intronic
1069802092 10:71088044-71088066 CAGAGAGATCTGTGAGAAGCTGG + Intergenic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070490846 10:76975112-76975134 CAGCGACACCAGTGAAAAGTGGG + Intronic
1071470658 10:85981876-85981898 GAGAGGGACCAGGGAGAAGGAGG + Intronic
1072242042 10:93505753-93505775 CAGAGAAATAAAAGAGAAGTGGG - Intronic
1072455870 10:95575307-95575329 CAGAGAGACCAGGGAGATATGGG + Intergenic
1072929868 10:99652741-99652763 CAGAGAGACCAGGGTGAGGTAGG - Intergenic
1073148287 10:101294639-101294661 CAGAGAGACCAGGTAGAAGGTGG + Intergenic
1073649893 10:105347177-105347199 CAGAGACAACAGAGAGAAATGGG - Intergenic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074232168 10:111548551-111548573 CAGAGAGGCCAGAGAGAAAAGGG - Intergenic
1074418289 10:113286407-113286429 CAGAGGGACCAGATACAAGAGGG - Intergenic
1074674636 10:115834458-115834480 CTGAGAGGCAAGGGAGAAGTAGG - Intronic
1074728565 10:116342815-116342837 CAGGAAGAACAGAGAGAAGCAGG - Intronic
1075860688 10:125674016-125674038 CAGAGAGAACAGAACCAAGTTGG - Intronic
1076121767 10:127941901-127941923 CAGAGCCACCAGTGAGAAGTTGG + Intronic
1076413531 10:130268263-130268285 CAGAGAAGCCAGAGAGGAGGCGG + Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077328154 11:1972506-1972528 GTGAGAGACCCGAGAGAAGGGGG - Intronic
1077737804 11:4809693-4809715 CAGGGAGACCTGAGAAAGGTAGG - Intronic
1078366987 11:10715095-10715117 CAGAGAGCACAGAGAAAAGCAGG + Intergenic
1078671153 11:13366887-13366909 CAGAAAGAGGACAGAGAAGTAGG - Intronic
1079222265 11:18573565-18573587 CAGAGATTGCAGAGTGAAGTAGG - Intronic
1079315524 11:19404947-19404969 CAGAGAGCACAGAGAGAGGAGGG - Intronic
1079641918 11:22816203-22816225 GAGAGAGAGGAGAGAAAAGTGGG - Intronic
1079645602 11:22860723-22860745 GAGAGAGACTAGAGAGATGAAGG - Intergenic
1081040378 11:38202556-38202578 CATACAGACCAGAAAGGAGTGGG + Intergenic
1081174220 11:39906893-39906915 CATAGATACCAGAGGGAAGTTGG + Intergenic
1081601586 11:44498920-44498942 CAAAGGCTCCAGAGAGAAGTGGG + Intergenic
1081757605 11:45555809-45555831 TAGAGGGACAAGAGAGAAGATGG + Intergenic
1081874945 11:46402066-46402088 CTGGGGGACCAGAGAGAAGTGGG - Intronic
1082167629 11:48966175-48966197 CAGAGAGACCAGGGAGAGTCTGG + Intergenic
1082239380 11:49855031-49855053 CAGAGAGACCAGGGAGAGTCTGG - Intergenic
1082242767 11:49889321-49889343 CAGAGAGACCAGGGAGAGTCTGG + Intergenic
1082614147 11:55338069-55338091 CAGGGAGAACAGAAACAAGTTGG - Intergenic
1082657260 11:55870130-55870152 CAGAGAGACCAGGGAGAGTCTGG + Intergenic
1082751722 11:57026114-57026136 CAGAGAGAGCTGAGAGAAAATGG - Intergenic
1083299704 11:61733993-61734015 CAGAGAGACCAGAGCCAGGTGGG + Intronic
1083749470 11:64753415-64753437 CCCAGAGACCAGAGAGTGGTCGG + Intronic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084283714 11:68117870-68117892 CAAAGGGACCAGACAGAAGGTGG + Intronic
1084322375 11:68380785-68380807 CACAGAGGCCAGAGAGAGGGTGG - Intronic
1084845653 11:71897568-71897590 TGGTGAGACTAGAGAGAAGTAGG + Intronic
1086143480 11:83524675-83524697 CAGAGATAACGCAGAGAAGTTGG - Intronic
1086970626 11:93076923-93076945 CAGAGAGTGCAGAGACAAGCTGG - Intergenic
1087412920 11:97814719-97814741 CAGAGATACAAGACAGAATTTGG + Intergenic
1088771302 11:113038267-113038289 CAAGGAGGCCAGAGAGCAGTGGG - Intronic
1088902623 11:114129546-114129568 AAGAGAGACCAGACAGAATCTGG - Intronic
1089113017 11:116072065-116072087 CAGAGAGAACAGATAGAGGCAGG - Intergenic
1089514702 11:119025120-119025142 CATATAGACCAGTGAGAAGCTGG - Intronic
1089870048 11:121664538-121664560 CATAGATGTCAGAGAGAAGTTGG + Intergenic
1090329102 11:125916182-125916204 GAGAGAGACCAGAGGGAAATCGG - Intronic
1091166934 11:133486840-133486862 GAGAGAGAGAAGAGAGAAGGGGG - Intronic
1091296969 11:134480729-134480751 CAGAGAGAACAGACAGATGGGGG + Intergenic
1202811133 11_KI270721v1_random:27686-27708 GTGAGAGACCCGAGAGAAGGGGG - Intergenic
1091446370 12:546169-546191 AAGAGGGAGCAGTGAGAAGTGGG + Intronic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1092077347 12:5684807-5684829 TAGAGATCCCAGAGAGAAGCTGG + Intronic
1092791970 12:12078263-12078285 GAGAGAGAGGAGAGAGAAGCCGG + Intronic
1092859364 12:12706878-12706900 CAAAGAGGCAAGAGAGAAGTAGG - Intergenic
1093149188 12:15601698-15601720 GAGAGAGACAAGAAAGAAGAGGG - Intergenic
1093254393 12:16848629-16848651 CATAGAGACCAAAGAGAGGTTGG + Intergenic
1096390998 12:51229006-51229028 CTGAGGGACCAGAGAGAGGCAGG - Intergenic
1097492823 12:60291561-60291583 GAGAGAGACCAGAGAGCACAGGG - Intergenic
1098013562 12:66080357-66080379 CAGTGAAACAAGGGAGAAGTGGG + Intergenic
1098214281 12:68199378-68199400 CAGAGAGACCTGAAGGAAATGGG + Intergenic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1100376628 12:94022432-94022454 CGGGGAGACCAGTGAGAAGATGG + Intergenic
1101212081 12:102544643-102544665 CAGAGAGATGAGAGAGAGCTGGG + Intergenic
1102256649 12:111418984-111419006 CAGAGTGTCCAGAGGGAACTAGG + Intronic
1104539211 12:129646585-129646607 GAGAGAGTCCAGAGAGTATTTGG - Intronic
1104729611 12:131097723-131097745 CGGAGAGACCAGAGACAGGCAGG + Intronic
1106142064 13:27019882-27019904 CAGAGAGAAAAGAGGAAAGTTGG + Intergenic
1106543681 13:30712941-30712963 CAGCATGGCCAGAGAGAAGTTGG - Intergenic
1106576285 13:30978874-30978896 CAAAGAGAGCAGAGAGATGATGG - Intergenic
1107703319 13:43072376-43072398 CAGAGAGATGAGAAAGATGTTGG + Intronic
1108146516 13:47483274-47483296 CAGAGAAAGAAGAGAGAAGTGGG + Intergenic
1108182773 13:47857304-47857326 CAGGGATACCATGGAGAAGTTGG + Intergenic
1108758825 13:53537716-53537738 CAGAAAGAAAAGAGAGAAGGGGG - Intergenic
1111037588 13:82698699-82698721 CAGAGAGAAAAGAGAGAAAAAGG + Intergenic
1111211043 13:85080780-85080802 CAGAGAGATGGGAGAGAAGGAGG + Intergenic
1111224272 13:85249036-85249058 CAGAGAGATCAGAGGAAAGGAGG + Intergenic
1111907259 13:94269724-94269746 CAGATAGACCAAAGAGAAAGTGG - Intronic
1111935268 13:94550845-94550867 GAGAGAGACCAAAGAGAGCTTGG + Intergenic
1112067209 13:95806002-95806024 CAGAGAGAACAGAGATAAGGGGG + Intronic
1113030606 13:105990036-105990058 CAAAGAAACCTGAGAGCAGTGGG - Intergenic
1113258041 13:108528781-108528803 AAGAGAGAGAAGAGAGAAGAGGG - Intergenic
1113283037 13:108811642-108811664 ATGAGAGAGGAGAGAGAAGTAGG - Intronic
1113424210 13:110194533-110194555 CCGAGAGCCCAGAGTGAAGCTGG + Intronic
1114883379 14:26814777-26814799 AAGAAAGACGAGAGAGAGGTGGG - Intergenic
1115239205 14:31238125-31238147 CCTAGAGACCAGAGAAAACTTGG - Intergenic
1117083742 14:52178378-52178400 TAGAAAGACCAGAGAGAACTTGG + Intergenic
1117327069 14:54678999-54679021 AAGAGATAGCAGGGAGAAGTGGG + Intronic
1118159920 14:63277836-63277858 CAGAGAGAAAAGAGAGAAGTGGG + Intronic
1118840017 14:69502862-69502884 CAGAGGGAGCAGAGAGAGGTAGG + Exonic
1118857732 14:69637169-69637191 CAGACAGAGCAGAAAGAGGTGGG - Intronic
1119866225 14:77977415-77977437 CTGAGAGAGGGGAGAGAAGTGGG + Intergenic
1119995154 14:79245398-79245420 GAGAGAGAGAAGAGAGGAGTAGG + Intronic
1120285962 14:82501915-82501937 CAGAGAGATCAGAAAGAATATGG - Intergenic
1120954674 14:90071495-90071517 CAGGGAGCACAGAGAGATGTGGG - Intronic
1121120553 14:91373194-91373216 CAGAGGGAGAAGAGAGAAGGTGG - Intronic
1121259626 14:92556613-92556635 CAGACAGACAACAGATAAGTGGG + Intronic
1121724663 14:96138375-96138397 CACAGATCCCAGAGAGAAGAAGG - Intergenic
1122304549 14:100753868-100753890 CACAGAGTTCAGAGAGAGGTGGG - Intergenic
1122381862 14:101313565-101313587 GAGAGAGCCCAGGGAGAAGCAGG - Intergenic
1122689927 14:103527455-103527477 CAGAGAGGCAAGAGGGAAGTCGG + Intergenic
1125550458 15:40540870-40540892 CAGAGAGCCCAGTGAGAAGCTGG + Intronic
1126249909 15:46555321-46555343 CAGAGAGAAGATAGAGAATTCGG - Intergenic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1126598446 15:50404910-50404932 CGGGGAGATCAGTGAGAAGTGGG - Intergenic
1127175150 15:56346237-56346259 CAGAGAGGCAGGAGAGAAGCAGG + Intronic
1127759916 15:62128774-62128796 AAGAGAGACCAGCAAAAAGTTGG - Intergenic
1127904416 15:63365728-63365750 AAGGGAGACCAGAGGGATGTAGG - Intronic
1128112057 15:65082660-65082682 CAATGAGGCCAGAGAGGAGTGGG - Intergenic
1128237393 15:66077643-66077665 CATAGAGACAAGAAAGACGTGGG + Intronic
1128523260 15:68389492-68389514 CAGAGGGACTAGAGAGATCTGGG + Intronic
1128764075 15:70240362-70240384 CAGGAAGAACAGGGAGAAGTGGG - Intergenic
1129226073 15:74171150-74171172 CAGGGAGACAAGTCAGAAGTCGG - Intergenic
1129692005 15:77719075-77719097 CGGAGGGTCCAGAGAGAACTGGG + Intronic
1131208972 15:90476764-90476786 CAAGGAGAAGAGAGAGAAGTTGG + Exonic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1131603282 15:93872201-93872223 GTGAGAGAGCAGAGAGAAGAGGG - Intergenic
1131643931 15:94321627-94321649 TAGAGAGAGCACAGAGAAATTGG - Intronic
1131905643 15:97139108-97139130 CAGAGAGAAAAGAAAGAGGTAGG + Intergenic
1131946157 15:97624087-97624109 CAGAGACATCAGAAAGAAATAGG + Intergenic
1131966266 15:97847231-97847253 GAGAGAGAACAGAGAGATGGAGG + Intergenic
1132185301 15:99798192-99798214 GAGAGAAAGCAGAGAGAAGCAGG + Intergenic
1132388966 15:101424921-101424943 CAGAGAGACGAAAGAGATGAGGG + Intronic
1132431686 15:101766370-101766392 GAGAGAAAGCAGAGAGAAGCAGG - Intergenic
1134120647 16:11581945-11581967 AAGAGAGGCTAGAGAGAGGTTGG + Intronic
1134225004 16:12382839-12382861 GAGAGGCACCAGAGAGAAGCAGG - Intronic
1134334759 16:13288188-13288210 CAGAGAGATAAGAGAAAAATGGG + Intergenic
1134537460 16:15037749-15037771 CCGATAGACCAGTGAGAGGTAGG + Exonic
1134650509 16:15904784-15904806 CAGAGTGACCAAAGAGCAGGTGG - Intergenic
1135834009 16:25806441-25806463 CAGACAGTCCAGGGAGAAGTGGG + Intronic
1136121900 16:28142202-28142224 AAAATATACCAGAGAGAAGTTGG - Intronic
1137070419 16:35899904-35899926 CTTAGAGACCAGTGAGAATTGGG - Intergenic
1137715547 16:50596107-50596129 CAGTGAGAGCAGTGAGAAGCAGG + Intronic
1138068385 16:53965690-53965712 CAGAGAGAAAAGAGAGAATGAGG - Intronic
1138373978 16:56549856-56549878 CAGAGACAACAGGGAGGAGTGGG - Intergenic
1138837873 16:60460040-60460062 CAGAGAGAACTGAGGGTAGTTGG - Intergenic
1139815830 16:69670903-69670925 CAGAGAGAGAAGAGAGAAACAGG + Intronic
1139948417 16:70657243-70657265 CAGAGGGACGTGGGAGAAGTGGG + Intronic
1139958292 16:70703711-70703733 CAGAGAAACCAAAGAGAAGCTGG - Intronic
1140899386 16:79353945-79353967 CATGGAGACCAGAGATAAGTGGG + Intergenic
1141471539 16:84241890-84241912 CAGAGAGAACTGAGAGGAATGGG - Intergenic
1141883730 16:86877717-86877739 CAGAGAGACCAGAGAGAGAGAGG - Intergenic
1141932292 16:87214065-87214087 GAGGGAGAGCAGAGACAAGTTGG + Intronic
1142308868 16:89300475-89300497 CAGAGAGAGCAGAGTGCAGCAGG - Intronic
1142712258 17:1730067-1730089 AAGAGAGGCCAGAGGGAAGGTGG + Intronic
1142913809 17:3117153-3117175 GAGAGACACCACAGAGAGGTGGG - Intergenic
1142946411 17:3433065-3433087 CAGTGACACCACAGAGAGGTGGG + Exonic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143528514 17:7486256-7486278 AGGAGAGACCAGAGAGAGGAGGG + Intronic
1143743254 17:8969706-8969728 CAGAGAGGACAGAGAGAGGAAGG - Intergenic
1144266417 17:13573859-13573881 CAGAGAGAGCAGAGAGAAGGAGG - Intronic
1144575654 17:16427869-16427891 CACAGAGACCAGAGGTAGGTGGG + Intronic
1144968050 17:19090006-19090028 CAATGAGACCAGAGAGGACTGGG + Intergenic
1144979867 17:19162057-19162079 CAATGAGACCAGAGAGGACTGGG - Intergenic
1144988355 17:19216175-19216197 CAATGAGACCAGAGAGGACTGGG + Intronic
1145305607 17:21673372-21673394 CAGAGCGACCTGAAAGAAGATGG - Intergenic
1146040468 17:29448603-29448625 CAGAGAGACAAGAGATAATTAGG - Intronic
1146711096 17:35042080-35042102 CAGAGAGAGGAGAGAGACCTTGG - Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147766683 17:42841484-42841506 TAGAGTGACCTGAGAGAAGAGGG - Exonic
1147844114 17:43392952-43392974 CTGAGAGGCCAGAGGGAATTCGG - Intergenic
1148521048 17:48275273-48275295 CAGGGAGATCAGAGAGAATAAGG - Intronic
1149006828 17:51814911-51814933 AAGAGAGACAAGAGAGAATCTGG - Intronic
1149479988 17:56995587-56995609 CAGAGAGGCCACAGAGCTGTGGG + Exonic
1149775654 17:59354892-59354914 CAGTGAGAGAAGAGAGGAGTTGG + Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1151397619 17:73834486-73834508 GAGAGAGACAAGACAGAACTAGG + Intergenic
1151441589 17:74132843-74132865 TACAGAGAGAAGAGAGAAGTGGG + Intergenic
1151467636 17:74297847-74297869 CATACAGAGCAGAGAGGAGTGGG - Intronic
1151925026 17:77189243-77189265 CACAGAGAACAGAGAGCAGATGG + Intronic
1152356304 17:79809351-79809373 CAAACAGACCAGCCAGAAGTGGG + Intergenic
1152840330 17:82563408-82563430 CAGCGAGAAGAGAGAGAAGCAGG + Exonic
1153521000 18:5953840-5953862 CAGAAAGACTAGTGAGAAGTGGG + Intergenic
1154010442 18:10569455-10569477 CACAGAGACAAGAGAGAAGGAGG - Intergenic
1154050764 18:10954822-10954844 CAGAGAGAAATGAGAGAAGAAGG - Intronic
1154078454 18:11229421-11229443 TAGAGAAAACAGAGAGAAGGAGG - Intergenic
1155036579 18:22029818-22029840 CAGTGAGAGCCGAGAGAAGGGGG + Intergenic
1155044084 18:22088583-22088605 CAGTGAGACAACAGAGAGGTTGG + Intronic
1155464378 18:26119688-26119710 CACAGAGAACAGAGAAAAGCAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156209050 18:34919340-34919362 CAGAGAGACTACAGAGCACTAGG - Intergenic
1156514563 18:37669209-37669231 CAGAAAGGGCAGAGGGAAGTGGG - Intergenic
1157698037 18:49739240-49739262 CAGGCAGACCAGAGTGAAGTTGG + Intergenic
1157885204 18:51359972-51359994 CAGAGAGGCCAGTGGGAAGCTGG - Intergenic
1159161982 18:64654428-64654450 AAGAGCAACGAGAGAGAAGTGGG + Intergenic
1159438175 18:68445050-68445072 CAAAGTGATCAGAGAGAACTTGG + Intergenic
1160059383 18:75515505-75515527 CAGCCAGACCACAGAGAAGCTGG + Intergenic
1161250466 19:3277103-3277125 AAGAAAGACCAGAGTGGAGTCGG - Intronic
1162516198 19:11149283-11149305 CAAGGAGAGCAGAGAGAAGGTGG + Intronic
1163207423 19:15813859-15813881 CAGAGAGAGGAAAGAGAGGTAGG + Intergenic
1163770695 19:19189335-19189357 CAGAGAGGCCAGGGAGAAGGTGG - Intronic
1163844526 19:19630725-19630747 AAGTGAGACCAAAGAGGAGTGGG + Intronic
1164050881 19:21585281-21585303 CAGAGAGGCCAGTGAGAGGCAGG + Intergenic
1165144526 19:33722784-33722806 CAGGGAGAAAAGAGAGATGTGGG - Intronic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166717487 19:44977683-44977705 CTCAGGGACCAGAGAGAAATTGG + Intronic
1166829950 19:45633156-45633178 CAGAGAGACCAGGGCTCAGTGGG + Intronic
1167459244 19:49615614-49615636 AACAGAGACCAGAGAGAGGAGGG + Intronic
1167564753 19:50249263-50249285 GACAGAGACCAGAGAGAGGGGGG - Intronic
1167576975 19:50322499-50322521 CATGGAGACCAGAGAGAGATGGG - Intronic
1167636399 19:50658479-50658501 CGGTGAGATCAGAGAGAAGGAGG + Intronic
1167749082 19:51368986-51369008 CACAGAGCCCAGAGAGACGGGGG + Exonic
1168189784 19:54729670-54729692 CACAGGGCCCAGAGGGAAGTTGG - Exonic
1168269207 19:55240472-55240494 TAGAAAGACCAGAGAGACTTGGG - Intronic
1202710561 1_KI270714v1_random:17346-17368 CAGAGAGATCAGAGCTGAGTGGG + Intergenic
925107714 2:1307465-1307487 GAGAGAGAAGAGAGAGAAGGAGG + Intronic
925592395 2:5523263-5523285 AACAGAGAAAAGAGAGAAGTAGG + Intergenic
925598940 2:5588451-5588473 TACAAAGAACAGAGAGAAGTGGG - Intergenic
925868125 2:8246579-8246601 GAGGGAGACCAGAGTGCAGTGGG - Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
927464695 2:23328504-23328526 GAGAGTGACCAGAGAGCAATGGG - Intergenic
928621346 2:33091300-33091322 CTCATAGACCAGAGAGAACTAGG - Intronic
928922374 2:36539136-36539158 CAGAGAGGCTGGGGAGAAGTGGG + Intronic
929930995 2:46255367-46255389 AAGAGAGGCCACAGAGAAGAAGG - Intergenic
930229148 2:48826492-48826514 CACAGAGAACAGAGAAAAGCCGG + Intergenic
930990933 2:57653617-57653639 CATAGAGACCAGAAGGTAGTGGG - Intergenic
931216944 2:60254179-60254201 CAGGGGGACCAGCCAGAAGTTGG - Intergenic
932133664 2:69209983-69210005 TACAGAGACCAGAGTGAAGCCGG + Intronic
932148753 2:69348725-69348747 GAGAGAGATCAGAGAGAAAGTGG - Intronic
932226387 2:70044410-70044432 AAGGGAGACCAGATAGCAGTGGG - Intergenic
932706672 2:74031318-74031340 CAGACAGGCCAGAGAGACGAGGG + Intronic
932939123 2:76141028-76141050 AAGAGAAAGCAGAGAGAATTAGG - Intergenic
934489666 2:94752724-94752746 CAGAGAGAGCAAAGGGAACTTGG - Intergenic
936073791 2:109388826-109388848 GAGAGAGACTAGAGAGAAGGGGG + Intronic
936444955 2:112587917-112587939 CAAGGAGACCAGAGAGAGGCTGG - Intronic
937800970 2:126079841-126079863 CAGAAAAAACAGAGAGAAGGAGG + Intergenic
938111004 2:128564968-128564990 CAGAGAGATAAGAGAGAACTGGG - Intergenic
939193580 2:138945187-138945209 CTAAGAGACTAGAGAGAGGTGGG - Intergenic
939445535 2:142305218-142305240 CAGAGAGACAAAAGAGAATTTGG + Intergenic
939513624 2:143139006-143139028 AAGAGAGACCAAAAAGAAGATGG - Intronic
940011767 2:149061740-149061762 CAGACAGAAAAGAGAGAAATGGG + Intronic
940102951 2:150062910-150062932 GAGAGAGAGGAGAGAGAGGTAGG + Intergenic
940125571 2:150319795-150319817 CTGAAAGTCCAGAGAGAAGAAGG - Intergenic
940392966 2:153154042-153154064 CAGAGGGAACAGAGACAAATGGG - Intergenic
940594788 2:155776658-155776680 CTGGGAGAACAGAGACAAGTAGG - Intergenic
940625829 2:156173659-156173681 CTGAGAGGCAGGAGAGAAGTTGG - Intergenic
940832872 2:158487787-158487809 GAGAGAGAAGAGAGAGAAGGGGG + Intronic
941244078 2:163075053-163075075 CAGGGAGTTCAGAGAGAAGCTGG - Intergenic
941416862 2:165231705-165231727 CAGAGAGAACAAAAAGAAGAGGG - Intergenic
942084999 2:172435495-172435517 CAGAGAGATTAGAGATAGGTAGG + Intronic
942797503 2:179839292-179839314 CAGAGAGAACTGTGAGCAGTTGG + Intronic
943178882 2:184515993-184516015 TAGAGAGACTAGAGAGAAGCAGG + Intergenic
945050530 2:205819983-205820005 CAGAGAGAAGAGAGAGAGGAGGG - Intergenic
946113324 2:217439077-217439099 CAGAGTTACTGGAGAGAAGTAGG - Intronic
946918317 2:224550069-224550091 CACAGAGACAAGAGAAAAGAGGG - Intronic
947074252 2:226324839-226324861 CAGAGAGGACAGAGGGCAGTGGG + Intergenic
947435593 2:230069326-230069348 CAGAAAGAGCAGGGAGAGGTGGG - Intergenic
948281457 2:236750489-236750511 CAGTGAGCACAGAGAGATGTAGG + Intergenic
948334723 2:237199004-237199026 CAGAGAGGACAGAGACAAGCTGG - Intergenic
948963715 2:241359645-241359667 CAGAGAGAGCAGAAAGAAAGAGG - Intronic
1168772541 20:424590-424612 CAGAGACAACAGAGAAAAATGGG - Intronic
1168912317 20:1458785-1458807 CACAGAGACCAGAGAGTTGAAGG + Intronic
1169024274 20:2354804-2354826 CACAGAGGCCAGAGATTAGTGGG + Intergenic
1169099217 20:2931271-2931293 TAGAAAGACCAGAGAGAACCTGG + Intronic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170370188 20:15639863-15639885 AAGAGAGAGGAGAGAGATGTAGG + Intronic
1170822667 20:19767521-19767543 CTGAGAGACCAGAGGGCAGGAGG + Intergenic
1170926136 20:20726138-20726160 AGGAGAGACCAGGGAGAACTGGG + Intergenic
1171063215 20:21986890-21986912 CAGAGACTCCAGAGAGAACACGG + Intergenic
1171105743 20:22430764-22430786 CAGAAAGACAAGAGAGAAGTAGG + Intergenic
1171396223 20:24835464-24835486 CAGTGAGACAGGAGAGAGGTTGG + Intergenic
1171500937 20:25592833-25592855 CTTAGAGGCCAGAGAGAAGTGGG + Intergenic
1171523124 20:25790861-25790883 CAGAGCGACCTGAAAGAAGGTGG - Intronic
1171530864 20:25852839-25852861 CAGAGCGACCTGAAAGAAGGTGG - Intronic
1171553703 20:26065022-26065044 CAGAGCGACCTGAAAGAAGGTGG + Intergenic
1172061901 20:32192125-32192147 AAGACAGAGCAGAGAGAAATAGG + Intergenic
1172146315 20:32760862-32760884 GGGAGATACCAGAGAGAAATGGG - Intergenic
1172927471 20:38551904-38551926 TGGAGAGACCAGGGAGAAGAAGG + Intronic
1173367700 20:42402130-42402152 CAGAGAGAGCACAGAGGTGTGGG + Intronic
1173865791 20:46312025-46312047 CAGAGAGACCAGAGACACTGAGG - Intergenic
1174506086 20:51018452-51018474 GAGAGAGACCTGAAAGCAGTTGG - Intronic
1174736888 20:52973213-52973235 CAGAGAGGCCAGAGAGACAGCGG + Exonic
1174791294 20:53480758-53480780 CAGAGAGTGAAGAGAGAAGGGGG + Intronic
1176146918 20:63569600-63569622 GGGAGCCACCAGAGAGAAGTCGG + Exonic
1176892808 21:14338909-14338931 CAGAGAGACTAGAATGAAGCAGG + Intergenic
1177077563 21:16596310-16596332 CAGAGCCAGCAGAGAGAACTTGG - Intergenic
1177268491 21:18814002-18814024 GAAAGAGAACAGAGAAAAGTGGG + Intergenic
1177366375 21:20143380-20143402 CTCAGAGAGCAGAGAGAAATAGG + Intergenic
1177390351 21:20460448-20460470 CTCAGAGACCTGAGAGCAGTAGG + Intergenic
1178724021 21:35035395-35035417 CAGAGAGGCCAGATGGGAGTGGG + Intronic
1179370655 21:40803555-40803577 CTGAGAGACGAAAGAGAAGGGGG - Intronic
1180929179 22:19577305-19577327 CAGAGAGAGAGGAGGGAAGTAGG - Intergenic
1181112594 22:20610720-20610742 GAGAGTGAACAGAGAGAAGCCGG + Intergenic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1182066352 22:27434255-27434277 CAGAGAGACCGTAGAGGAGCTGG + Intergenic
1182073071 22:27476957-27476979 CAGAGACAGCAGACAGAAGCAGG + Intergenic
1182253095 22:29017550-29017572 AAGAGGGACCACAGAGAAGCTGG + Intronic
1182515249 22:30854946-30854968 CAAGGAGAACAGAGCGAAGTTGG + Intronic
1182974161 22:34606904-34606926 CAGGGAGACTAGAGAGATGATGG - Intergenic
1183390087 22:37540772-37540794 CAGAGGGACCAGTTAGGAGTAGG - Intergenic
1183583304 22:38738269-38738291 CAAAGAGAGCGGAGGGAAGTGGG + Intronic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184003980 22:41695604-41695626 AAGAGAAACCTGAGAGAAGTTGG + Exonic
1184004003 22:41695775-41695797 GAGAGAAACCAGAGAGAACCTGG + Exonic
1184004027 22:41695940-41695962 AAGAGAAACCAGAGAGAGGTTGG + Exonic
1184144312 22:42599891-42599913 CAAAGGGACCAAGGAGAAGTGGG + Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185331062 22:50252226-50252248 CAGAGAGACCAGTGAGGGGCAGG - Intronic
950108319 3:10402349-10402371 CTGAAAGACCAGATAGAAGCAGG + Intronic
950723222 3:14899255-14899277 CAGAGAGATGGGAGGGAAGTGGG - Intronic
951206847 3:19934394-19934416 GAGAGAGAGGAGAGAGAAGGGGG - Intronic
952055489 3:29439952-29439974 CAGGAAGACCAGACGGAAGTCGG + Intronic
952158353 3:30668356-30668378 CACAGAGACCGGAGACAAGTGGG + Intronic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
953197982 3:40751982-40752004 GGGAGAGATCAGAGGGAAGTGGG + Intergenic
954493159 3:50926850-50926872 CAGGGAGACCAGTTAGAAGGTGG - Intronic
954871236 3:53769076-53769098 CTGAGAGAACACAGAGGAGTTGG - Intronic
955195413 3:56801368-56801390 CTGAGAGTCCAGACAGAAGATGG + Intronic
955289234 3:57675537-57675559 TAAAGGGACCAGAGAGAATTAGG - Intronic
956192711 3:66622488-66622510 CAGAGAGAGCAGAGGAAAGTGGG - Intergenic
956657539 3:71566917-71566939 CTGAGAGCCCAGGGAGAAGATGG - Intronic
956694481 3:71906905-71906927 GAGAGGGAACAGAGAGGAGTAGG + Intergenic
957174344 3:76786468-76786490 CAGAAAGAAGAGAGAGAAGGGGG + Intronic
957321549 3:78637871-78637893 CGGAAAGGCGAGAGAGAAGTTGG - Intronic
958676187 3:97272067-97272089 CAGAGGAAAAAGAGAGAAGTAGG - Intronic
959983854 3:112550475-112550497 CAGATAGACCCAAGAGAATTTGG + Intronic
960052105 3:113248950-113248972 CACCGGGAGCAGAGAGAAGTGGG + Intronic
960088738 3:113617358-113617380 CAGAGAGCCAAGAGAGAGCTGGG - Intronic
960445252 3:117740455-117740477 CAGACTAACCAGAGATAAGTTGG - Intergenic
961390011 3:126546820-126546842 CAGTTAGCCCATAGAGAAGTAGG - Intronic
961546798 3:127639940-127639962 CAGAGACAGCATAGAGCAGTAGG - Intronic
962681164 3:137801794-137801816 CAGAGAGAAGAGAGAAAGGTCGG - Intergenic
963057709 3:141200963-141200985 CAGACAAGCCAGAGAGAAGAAGG + Intergenic
963343532 3:144067213-144067235 CAGAGAGACCAGTTAGAGGGTGG - Intergenic
964193862 3:154038856-154038878 AGGAGACACCACAGAGAAGTAGG + Intergenic
964386085 3:156149504-156149526 CAAAGACTCCAGAGATAAGTAGG + Intronic
964765016 3:160171230-160171252 CAGAGAGACCATTTAGATGTGGG + Intergenic
965459765 3:168947553-168947575 CAGAGAGACCAGCTAGAAGCTGG + Intergenic
966002942 3:174972452-174972474 TAGAGAGCGCAGAGAGAAGGTGG - Intronic
966916230 3:184585592-184585614 CAGAGAGACCTGAATGGAGTTGG - Intronic
967344049 3:188433710-188433732 AAGAGAGGCCAGAGAGAAAGAGG + Intronic
967674032 3:192274568-192274590 AAGAGAGAGGAGAGAGAAGAGGG + Intronic
970224426 4:13842785-13842807 GAGAGAGAAGAGAGAGAAGGAGG - Intergenic
970485538 4:16521100-16521122 CAGGGAGATTAGAGAGAAGCAGG + Intronic
972711405 4:41599296-41599318 CAGAGAGGCAAGAAAGAAATAGG + Intronic
972930869 4:44070639-44070661 CAGAGAATGCAGAGAGAAATTGG + Intergenic
972997667 4:44902142-44902164 CAGAGAAACCAGACAGAGCTTGG - Intergenic
973220738 4:47723277-47723299 CAGGGAGATCACAGAGAAGAGGG + Intronic
973565206 4:52179165-52179187 CACAGAGGCCAGAAAGCAGTGGG + Intergenic
973639457 4:52888300-52888322 CAGAGAGAAGAGAGAGGACTGGG + Intronic
973942720 4:55926575-55926597 GAGAGAGACAAGAAACAAGTGGG + Intergenic
974152586 4:58028442-58028464 CAAAGACAGCAGAAAGAAGTGGG - Intergenic
974928828 4:68337128-68337150 GAGAGAGACCAGAAAGAGGAGGG - Exonic
975304120 4:72828674-72828696 AAGAGATACAAGAGAGAAATTGG - Intergenic
975637026 4:76460661-76460683 CAGAGAGACACCAGAGATGTGGG - Intronic
975785370 4:77881869-77881891 GAGAGAGACCTGAAGGAAGTAGG - Intronic
976376327 4:84349792-84349814 AAGAGAGACTTGAGAGAACTTGG - Intergenic
976897583 4:90129603-90129625 CACAGAGAAAAAAGAGAAGTTGG + Intronic
977233621 4:94480774-94480796 CAGAGAGGGCAGAGAAAAGCAGG + Intronic
977348817 4:95853441-95853463 CTGAGAGACAAGAGGGAAGGAGG + Intergenic
979041296 4:115800257-115800279 CAGGGAGACAGGAGAGAAGGGGG - Intergenic
980140468 4:128909997-128910019 CAGAGAAACCAGAGTGAAGGCGG + Intronic
980165133 4:129216666-129216688 AAGACAAACCAGATAGAAGTAGG - Intergenic
980447046 4:132922894-132922916 CAATAAGACCAGAGAGAGGTAGG - Intergenic
981144601 4:141309829-141309851 CAGAGAGAGCAGACAGCAGGAGG + Intergenic
982847012 4:160266915-160266937 CAGAGAGTTTAGAGAGAAGGAGG - Intergenic
983054502 4:163085629-163085651 CAAAGAGACCCAAGATAAGTAGG - Intergenic
983569361 4:169187961-169187983 CAGAGACATCAGAGTGAAGAAGG + Intronic
984937194 4:184899623-184899645 TTGAGAGGCCAGAGAGGAGTGGG - Intergenic
985299217 4:188469838-188469860 AAGTGCTACCAGAGAGAAGTAGG + Intergenic
985860584 5:2467515-2467537 TATAAAGAACAGAGAGAAGTGGG - Intergenic
986019978 5:3792077-3792099 CAGAGAGACTTGAGAGGGGTGGG + Intergenic
986549888 5:8940810-8940832 CAGAGGGAAGAGAGAGAAATGGG + Intergenic
986835765 5:11635315-11635337 CAGAGAGAACAGTGAGAAACTGG + Intronic
987017665 5:13836859-13836881 CAGAGACACAAGACAGAAGAAGG + Intronic
987062509 5:14256198-14256220 GAAAGAGAAGAGAGAGAAGTGGG + Intronic
989167573 5:38446245-38446267 CAGAAAGGCCAGGGAGAAGGAGG - Intronic
989734507 5:44687765-44687787 AAGAGGAAGCAGAGAGAAGTGGG + Intergenic
990143697 5:52734441-52734463 TAAGGAGATCAGAGAGAAGTAGG - Intergenic
990515935 5:56530885-56530907 CACAGAGACCAGAGAGGAAGGGG - Intronic
990749753 5:59001558-59001580 TAGGGAGACCAGAGAAAAGGAGG - Intronic
990835033 5:60008815-60008837 CTAAAACACCAGAGAGAAGTAGG - Intronic
990995857 5:61731691-61731713 GAGAGAGAGGAGAGAGAGGTGGG + Intronic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
991226165 5:64275659-64275681 CAGGGAGAAAAGAGAGAAGAAGG - Intronic
992102578 5:73421492-73421514 TATAGAAACCAGGGAGAAGTTGG - Intergenic
992558729 5:77929309-77929331 AAGAGATGCCAGAGAGAAGGGGG + Intergenic
992653230 5:78882324-78882346 CTGAGAGACAAGAGAGCAGGAGG + Intronic
993481389 5:88429263-88429285 CAGAAAGAACAGAAAGGAGTAGG - Intergenic
993805066 5:92397056-92397078 CAGTAAGATCAGAGATAAGTTGG - Intergenic
994996833 5:107074695-107074717 AAGAGAAACTAGAGAGAATTAGG + Intergenic
996737031 5:126767517-126767539 CAGAGAGAAGAGAGAGAAAGAGG - Intergenic
997211946 5:132082023-132082045 CAGAGAGACCACACATAAGGAGG + Intergenic
997738309 5:136231122-136231144 CAGCGAGAGCAGAAAGAACTGGG - Intronic
997964760 5:138348178-138348200 CTGAGAGACCATAGGGAGGTTGG + Exonic
998477869 5:142436556-142436578 GAGAGATAGCAGAGAGAGGTGGG - Intergenic
998495824 5:142588473-142588495 GAGAGAGAGAAGAGAGAAGAGGG - Intergenic
999186288 5:149712422-149712444 AAGAGAGACTAGAGAGACCTGGG + Intergenic
999250409 5:150179261-150179283 CAGCTCCACCAGAGAGAAGTTGG + Intronic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
999888940 5:155956152-155956174 CAGATGAACCAGAGAGAACTTGG - Intronic
1000152090 5:158513148-158513170 GAGAGAGAGAGGAGAGAAGTTGG + Intergenic
1000275791 5:159733623-159733645 CAGACAGACCAAAGGGGAGTAGG + Intergenic
1000454320 5:161430408-161430430 AAGTGATACCAGAGAAAAGTGGG - Intronic
1001281942 5:170392290-170392312 CAGAGAGAGCACAGAGCAGGTGG - Intronic
1001478028 5:172064819-172064841 CAGAGACAGCAGAGAGTAGCTGG + Intronic
1001517176 5:172364180-172364202 CAGAGACCCCAGAGAGAAGCGGG + Intronic
1001524203 5:172417050-172417072 CAGAGAGGCCACTGAGGAGTTGG - Intronic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1003983020 6:11407213-11407235 CAAAAAGAACAGAGAGTAGTTGG + Intergenic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005143682 6:22663378-22663400 AAGAGAGAACAGAGAACAGTGGG - Intergenic
1005187524 6:23179943-23179965 CAGAGAGACCAATGAGAAAAGGG - Intergenic
1006047994 6:31315181-31315203 CAGAGAGAACAGAGATAAACAGG - Intronic
1006335349 6:33417687-33417709 CAGAGAGGCCTGAGAGCAGGAGG + Exonic
1006682626 6:35808068-35808090 CAGAGAGACTACAGAGAACAGGG - Intronic
1006936857 6:37724569-37724591 CAGATAGAACAGAGAGAGGGAGG + Intergenic
1007167950 6:39841493-39841515 CAGAGAGGCTAGAGAGAGCTTGG + Intronic
1007286306 6:40750000-40750022 AAGAGAGACCAGAGATGAGAAGG - Intergenic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1007751589 6:44074800-44074822 CAGAGAAACAAGTGAAAAGTGGG + Intergenic
1007778834 6:44239527-44239549 CAGAGAGACCAGTCAGGGGTGGG - Intergenic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1008137702 6:47795749-47795771 GAGAGAGAGAAGAGAGAAGTGGG - Intronic
1008581208 6:52908981-52909003 CAAAGAGAACAAAGAGAAGGAGG + Intronic
1008635700 6:53408357-53408379 CAGAGAGAGGGGAGAGAAGGTGG + Intergenic
1010116896 6:72323546-72323568 CAGAGAGAAGAGACAGAAATTGG + Intronic
1010666298 6:78633775-78633797 CTTAGAGACCAGAAATAAGTGGG - Intergenic
1010936110 6:81863874-81863896 CAGGGAGACCAGAGACACTTTGG - Intergenic
1011337455 6:86276627-86276649 CAGAGAGAGAACACAGAAGTTGG - Intergenic
1011788876 6:90876521-90876543 CACAGACACAAGAGAGGAGTTGG + Intergenic
1011865907 6:91826618-91826640 TAGAGGGAACAGAGAGAAGATGG - Intergenic
1012482552 6:99683603-99683625 CAGAGAGAACAAAGAAAATTTGG + Intergenic
1012858763 6:104533843-104533865 GAGAGAGAGGAGAGAGAAGAGGG - Intergenic
1013655527 6:112242923-112242945 CAGAGGGTCCAGAGAGGAGAAGG - Intronic
1013786744 6:113789733-113789755 CAGTGAGGCCAGGGAGCAGTGGG - Intergenic
1014904823 6:127013262-127013284 GAGAGAAAGAAGAGAGAAGTTGG + Intergenic
1016002562 6:139057149-139057171 CAGATAGACCAGTGTGAAGCAGG + Intergenic
1017346860 6:153393334-153393356 GAGAGATAACAGAGAGAAGGGGG - Intergenic
1017359002 6:153543660-153543682 AAGAAAGACTAGAGGGAAGTGGG - Intergenic
1017566903 6:155696712-155696734 CAAAGAGAACCCAGAGAAGTGGG + Intergenic
1017711024 6:157168118-157168140 CAGAGAGGCCAGAAAGGAGGTGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1019092748 6:169553134-169553156 CAGAGAGACCAGAGCACTGTGGG + Intronic
1020171866 7:5851290-5851312 GAGAGAGGACAGAGAGAGGTTGG - Intergenic
1020440821 7:8214971-8214993 GAGGTAGACCAGAGAGAAATGGG - Intronic
1021084813 7:16409455-16409477 CAGAGAGACCAGGTAGGAGGTGG + Intronic
1021920835 7:25483385-25483407 CACAGGGACCAGAGAGCAGATGG + Intergenic
1022318446 7:29265656-29265678 GAGAGAGACATGAGAGAAGAGGG + Intronic
1022663193 7:32385733-32385755 CAGGGGAACCAGAGAGAATTTGG + Intergenic
1022797842 7:33746402-33746424 CAAGGAGACAAGAGAGAGGTCGG + Intergenic
1022838226 7:34136978-34137000 CAGAGAAAGCAGAGAGCAGAGGG + Intronic
1023235880 7:38086228-38086250 CAGAAAGAAGAAAGAGAAGTGGG - Intergenic
1024037238 7:45517898-45517920 CATGGAGACCAGAAATAAGTTGG + Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024216948 7:47255957-47255979 CACAGATCCCAGAGAGAAGAAGG - Intergenic
1024673401 7:51616880-51616902 CAGAGTGACCAGAGAGAACTGGG + Intergenic
1025813865 7:64891903-64891925 CAGAGAGGCCAGTGAGAGGCAGG - Intronic
1025818853 7:64945032-64945054 CAGAGAGGCCAGTGAGAGGCAGG + Intergenic
1026015831 7:66669909-66669931 CAACGAGAACAGAGGGAAGTGGG - Intronic
1026455482 7:70568742-70568764 CAGGGAGACCAGAGCCAACTGGG + Intronic
1026857267 7:73762997-73763019 GAGAGAGAGGAGAGAGAAGGGGG - Intergenic
1026862573 7:73800574-73800596 TAGAGAGAACAGAGAGAATAGGG - Intronic
1026962431 7:74417368-74417390 CAGGCAGAGCAAAGAGAAGTGGG - Intergenic
1027289706 7:76692706-76692728 GAGAGAGATGAGAGAGCAGTTGG - Intergenic
1028175674 7:87655568-87655590 GAGAGGGATCAGAGAGATGTTGG + Intronic
1028632274 7:92947890-92947912 CAGAGAGATGAAAGAGATGTGGG + Intergenic
1028912268 7:96221985-96222007 GAGAGACACAAGAGAAAAGTTGG + Intronic
1030179830 7:106694769-106694791 GAGAAAGGGCAGAGAGAAGTGGG - Intergenic
1030396726 7:108995388-108995410 CAGAGAGACCAAAAAGAATCTGG - Intergenic
1030508649 7:110455944-110455966 GAGAGAGAGAAGAGAGAAGAGGG + Intergenic
1030638275 7:111974644-111974666 GGGAGAGACCAGGGGGAAGTAGG + Intronic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1031998250 7:128246909-128246931 CAGGGAGTGCAGAGAGAAGTGGG + Intronic
1033254955 7:139792433-139792455 CAGAGAGAATAAAGACAAGTAGG - Intronic
1033609849 7:142954536-142954558 AAGAGAGACTGGAGAGAAGCAGG + Intronic
1034166903 7:149032247-149032269 CAGAAAGACCAAATAGAAGGTGG + Intergenic
1035581972 8:746155-746177 CAGAGAGACCAGGCCAAAGTGGG + Intergenic
1035587157 8:785533-785555 CAGAGAGACCTGAGGGGAGGAGG - Intergenic
1035826077 8:2645413-2645435 CAATGAGACCAGTGAGAAGTAGG - Intergenic
1036296300 8:7540926-7540948 CAGAGAGACCACAGTGAGGGAGG - Intronic
1036326266 8:7780093-7780115 CAGAGAGACCACAGTGAGGGAGG + Intronic
1036582993 8:10093931-10093953 CATGGAGACCAGAAAGCAGTGGG - Intronic
1036641421 8:10586505-10586527 CAGATTGTACAGAGAGAAGTAGG + Intergenic
1036975029 8:13401264-13401286 CAGAGAGGCCACAGAGAAATGGG - Intronic
1037378498 8:18258871-18258893 CTCAGAGACCATAGAGGAGTGGG + Intergenic
1037475321 8:19251465-19251487 CAGAGAGTGGAGAGGGAAGTGGG + Intergenic
1038090596 8:24248663-24248685 CAGACAGACCAGGAAGAAGATGG + Intergenic
1038272031 8:26082999-26083021 CAGAGACACCACAGAGAACAAGG + Intergenic
1038738560 8:30195619-30195641 CACAGAGACCAGAAAGCAGTAGG + Intergenic
1039093929 8:33862741-33862763 CAAAGACATCAGTGAGAAGTTGG - Intergenic
1039358964 8:36854042-36854064 AATAGAGGCCAGAAAGAAGTAGG - Intronic
1039492750 8:37960149-37960171 CACAAAGACCAAAGACAAGTGGG + Intergenic
1039823511 8:41154389-41154411 CAGATGGAGCAGAGAGAAGGAGG + Intergenic
1040881905 8:52214459-52214481 CAGAGAGAACAGCGACAAGAGGG + Intronic
1040912326 8:52531645-52531667 CATAGGGACCAGACAGAAGAGGG + Intergenic
1041664495 8:60429578-60429600 CAGGGAGACCTGTGAGAAGTTGG - Intergenic
1042310507 8:67374700-67374722 CAGGTGGACCAGAGAGAAGGTGG - Intergenic
1042858276 8:73289028-73289050 CATAGAGAACAGAGTAAAGTGGG - Intergenic
1043154093 8:76756423-76756445 CAGAGAGACCAGATTGAGGTTGG + Intronic
1043849809 8:85203916-85203938 CACAGATACCTGAGAGAAGACGG - Intronic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047510568 8:125512469-125512491 CAAAGAGTCCAGAGAGGTGTTGG + Intergenic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048787262 8:138063470-138063492 GAGTGAGACCAGAGTGGAGTGGG + Intergenic
1048974536 8:139663576-139663598 CAGAGAGACCACAGAGACAGAGG + Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049715008 8:144085668-144085690 CAGGAAGCCCAGTGAGAAGTTGG - Exonic
1050112916 9:2235103-2235125 GAGACAAACCAGAGAGAAGGTGG + Intergenic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1050683396 9:8140107-8140129 CAGAGAGAGTAGAGACCAGTAGG + Intergenic
1051446578 9:17146271-17146293 AAGAGAGAAAAGAGAGAAGAAGG - Intronic
1051816512 9:21113371-21113393 CACAGAGGCCAGAGGGTAGTGGG + Intergenic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1052195174 9:25703891-25703913 CAGAGAGAAAAGATAGAAGCTGG + Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1053917932 9:42957817-42957839 CAGAGAGAGCAAAGGGAACTTGG + Intergenic
1055343448 9:75309355-75309377 CAGAGAGAGCAAAGAAAAGCAGG - Intergenic
1055717105 9:79129860-79129882 CTGAGAGACCAGAAAAAAGGCGG + Intergenic
1055946548 9:81696387-81696409 GAGAGAGACAGGAGAGAAGTGGG + Intergenic
1057204661 9:93164091-93164113 CAGAGTGTCCAGGGAGAAGCTGG - Intergenic
1058049427 9:100391866-100391888 AAGAGAAACCAGAAAGAATTTGG - Intergenic
1058051239 9:100409063-100409085 CAGGGAGGCCAGGGAGATGTTGG + Intergenic
1058161858 9:101578790-101578812 CAGAGAGAACAGGGGCAAGTGGG + Intronic
1058172994 9:101705283-101705305 CAGAGAGCGCAGAGAACAGTAGG + Intronic
1059495046 9:114702532-114702554 CAGAAAGACCCCAGAGATGTGGG - Intergenic
1059705390 9:116818335-116818357 GAGATGGTCCAGAGAGAAGTGGG - Intronic
1060325273 9:122608595-122608617 CAGAGAGACTACAGAGAGGTGGG - Intergenic
1061088700 9:128414147-128414169 GAGAGAGAACTGAGAGTAGTTGG - Intronic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1203620503 Un_KI270749v1:123484-123506 AAGAGAGGCGAGAGAGAGGTGGG - Intergenic
1186217732 X:7317822-7317844 CAGAGAGAACACAGTGAAGAGGG - Intronic
1186249817 X:7653406-7653428 CAGAGAGAAAAGAGAGAAAGGGG - Intergenic
1186930193 X:14380858-14380880 GAGACAGATGAGAGAGAAGTGGG + Intergenic
1189318053 X:40069651-40069673 CAGAGGGACCTGGGAGAAGTGGG - Intronic
1189327530 X:40121914-40121936 CAAAGAGACCAGAGAGGATCTGG - Intronic
1190446814 X:50533957-50533979 CAGAGAGACCAGATAATATTAGG + Intergenic
1191936741 X:66435131-66435153 CAGAGAGACCAAAGAGAGCAAGG + Intergenic
1192320898 X:70089794-70089816 AAGAGAGAGGAGAGAGAAGGGGG - Intergenic
1193786512 X:85766195-85766217 CAGAGAGGACAGAGAGAGATGGG + Intergenic
1194620873 X:96169813-96169835 CAGAGAGAGCAGAAAGAAATGGG + Intergenic
1194879099 X:99227667-99227689 CAGAGAGAAAAGGGAGAAGAAGG + Intergenic
1195469842 X:105219470-105219492 CATGGAGACCACAGAGAAGCTGG - Exonic
1197203944 X:123773709-123773731 CATAGATCCCAGAGAGAAGAAGG + Intergenic
1197635781 X:128913479-128913501 GAAAGAGACCTAAGAGAAGTAGG - Intergenic
1198278570 X:135120286-135120308 CAGAGACACTATAGAGCAGTGGG - Intergenic
1198292391 X:135252230-135252252 CAGAGACACTACAGAGCAGTGGG + Intronic
1198298302 X:135308498-135308520 CAGAGAAACTATAGAGCAGTGGG + Intronic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1199852450 X:151735415-151735437 CAGAGACACCAGGCAGCAGTAGG - Intergenic
1200744602 Y:6892905-6892927 CTTAGAGACCAGTGAGAATTAGG + Intergenic
1201643512 Y:16202848-16202870 CCTAGAGACCAGTGAGAATTGGG + Intergenic
1201659303 Y:16382473-16382495 CCTAGAGACCAGTGAGAATTGGG - Intergenic
1202128359 Y:21588327-21588349 CAGAGATATCAGAGAGCAGAAGG + Intergenic
1202150931 Y:21843130-21843152 CAGAGATATCAGAGAGCAGAAGG - Intergenic