ID: 911440396

View in Genome Browser
Species Human (GRCh38)
Location 1:97919829-97919851
Sequence TTATGGAGCCTGGAGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911440392_911440396 27 Left 911440392 1:97919779-97919801 CCACATAATACACTTTGGCTCTT 0: 1
1: 1
2: 0
3: 15
4: 153
Right 911440396 1:97919829-97919851 TTATGGAGCCTGGAGAAAACAGG 0: 1
1: 0
2: 1
3: 15
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911440396 Original CRISPR TTATGGAGCCTGGAGAAAAC AGG Intronic
902377624 1:16037200-16037222 TAATGGATCATGGAGAAAGCTGG - Intergenic
902382798 1:16060459-16060481 TAATGGATCATGGAGAAAGCTGG - Intronic
904172421 1:28600693-28600715 TTATGCAGACTGAAGAAAAGTGG + Intronic
904696282 1:32333411-32333433 TTTAGGAGCCTGAAAAAAACAGG - Exonic
908616708 1:65930381-65930403 TTCTGGAGTCTGGAGAACAGTGG - Intronic
909757017 1:79239641-79239663 TTCTGGAGTCTGGAGAATAGTGG + Intergenic
910316603 1:85891634-85891656 TTAAGGATCCTGGAGTAAATAGG - Intronic
910625870 1:89305792-89305814 TTATGGAAGCTGGAAAACACTGG + Intergenic
911440396 1:97919829-97919851 TTATGGAGCCTGGAGAAAACAGG + Intronic
911790954 1:102014711-102014733 TTCTGGAGTCTGGAGAATAATGG - Intergenic
912275000 1:108246995-108247017 TTGAGCAGCTTGGAGAAAACTGG + Intergenic
912293222 1:108447356-108447378 TTGAGCAGCTTGGAGAAAACTGG - Intronic
915752410 1:158224025-158224047 TTCTGGGGCCTGGAGAACAGTGG - Intergenic
916357746 1:163931958-163931980 TTAAAGAGCAGGGAGAAAACTGG + Intergenic
917752648 1:178067539-178067561 TTCTGGAGAATGGAGAAGACGGG + Intergenic
919582465 1:199393380-199393402 TTATGGAGGCTGGAAGAAAGTGG + Intergenic
922006277 1:221533755-221533777 TTATGAATCTTGGAGAAAAATGG + Intergenic
923450573 1:234113269-234113291 GGATGGAGCCAGGAGAAACCTGG + Intronic
1062772886 10:117817-117839 TTATGGAACATAGAAAAAACTGG - Intergenic
1063875400 10:10471922-10471944 TTATGGAGCCTGGATAATATTGG - Intergenic
1064053968 10:12081812-12081834 TTTTTGAACCTTGAGAAAACAGG - Intronic
1064927402 10:20584386-20584408 ATAAGGACCCTAGAGAAAACTGG - Intergenic
1066645419 10:37602653-37602675 CTATGGAGCCTGGTGATAGCTGG - Exonic
1067731880 10:48818507-48818529 TCAGTGAGCCTGGAGGAAACTGG - Intronic
1068828690 10:61468675-61468697 TTATGGATCCTACAGAAACCTGG - Intergenic
1069174961 10:65279482-65279504 TTCTGGAGCCTGGAGAAGGGTGG - Intergenic
1069763771 10:70835988-70836010 TTATGGAAGCCTGAGAAAACTGG + Intronic
1070521819 10:77260341-77260363 GGCAGGAGCCTGGAGAAAACAGG + Intronic
1070853824 10:79589358-79589380 TTATGGAGCATGGGGAGAAGAGG - Intergenic
1072994575 10:100231517-100231539 TTGTGGAGCCTGGGGTCAACAGG - Intergenic
1073053077 10:100681669-100681691 TTTTGGAGACTGGACAAAAGAGG - Intergenic
1073611831 10:104951738-104951760 TTTTGAACCCTGGAGAAAACTGG + Intronic
1074193495 10:111158715-111158737 ATATGGAGCCTGGAGAGGGCTGG + Intergenic
1074484665 10:113863444-113863466 TTATGGCACATGGTGAAAACAGG + Intronic
1074715939 10:116218663-116218685 TTATTGTGCCTGGAGGAAGCAGG - Intronic
1075089751 10:119437043-119437065 CTTTGGAGGCTGGAGAACACTGG - Intronic
1078412908 11:11142391-11142413 TTATGGAGCCTGATGGAAATGGG + Intergenic
1080748092 11:35127042-35127064 TTCTGCATCCTGGAGAAAGCAGG + Intergenic
1081814692 11:45931987-45932009 TTCTGGTGCCTGGAGCCAACAGG + Intronic
1082209174 11:49476856-49476878 TTAAGGAGCCTTGGGAAAATTGG - Intergenic
1084051482 11:66603049-66603071 TTCTGAAGCCTGGAGTAACCAGG + Intronic
1084943279 11:72625659-72625681 TTGTGGGGTTTGGAGAAAACAGG + Intronic
1086933789 11:92722518-92722540 TTCTGGGGCCTGGAGAACAGTGG + Intronic
1090027021 11:123176595-123176617 CTAAGGAGCCAGGAGAGAACAGG - Intronic
1090405097 11:126471687-126471709 CTATGGAGCCTGATGAAAAAAGG + Intronic
1090760164 11:129829708-129829730 CTATTCAGCCTGGAGGAAACAGG - Intronic
1091038329 11:132253966-132253988 ATATGGAGTCTGGAGAAATGAGG + Intronic
1092750213 12:11711939-11711961 TGCTGGAGCCTTGACAAAACAGG - Intronic
1095299446 12:40565625-40565647 TTATGTAGCCTGGAGACATATGG + Exonic
1096748529 12:53744230-53744252 TTAAGGAGCCTGGAGAAGGTGGG - Intergenic
1102004279 12:109579177-109579199 TTATGCAGCCTGGAGTACAGTGG + Intronic
1106206141 13:27597014-27597036 TGATTGAGACTAGAGAAAACAGG - Intronic
1106762323 13:32879450-32879472 TTCTGGAGCCTGAAGGTAACAGG - Intergenic
1106910646 13:34459920-34459942 TCAAGGAGCCTGGAGACAAGGGG - Intergenic
1108955180 13:56144803-56144825 TAATGGATCATGGGGAAAACTGG + Intergenic
1110125256 13:71934229-71934251 TCATGGTTCCTGGAGAACACAGG + Intergenic
1112815962 13:103273817-103273839 TTATGGAGCCAGGAGAAGACAGG + Intergenic
1113762110 13:112855970-112855992 TAATGAAGCCTCGAGAAGACGGG + Exonic
1115273102 14:31576610-31576632 ATAGAGAGCCTGGAGCAAACTGG - Intronic
1115307691 14:31949433-31949455 TTTTGGAGCCAGAAAAAAACTGG - Intronic
1117700334 14:58406031-58406053 TTAAGAAGACTGCAGAAAACTGG - Intronic
1118729595 14:68656966-68656988 TTAAGCAGCCTGGTTAAAACAGG + Intronic
1119005401 14:70922418-70922440 TTTTATAGCATGGAGAAAACCGG + Intronic
1119005454 14:70923275-70923297 TTTTATAGCATGGAGAAAACTGG - Intronic
1119353594 14:73987118-73987140 TTATGGAGCCTGGGGAAAGGTGG - Intronic
1119596089 14:75935441-75935463 TCATGCAGCCTGGAGATAACAGG - Intronic
1122299202 14:100722527-100722549 GCATGGAGCCTGGAGGAAAGTGG - Intergenic
1124355808 15:28993913-28993935 TTAGGGTGCCTGGAGAGGACAGG + Intronic
1124554636 15:30712966-30712988 GAGTGGAGCCAGGAGAAAACAGG + Intronic
1124676612 15:31692714-31692736 GAGTGGAGCCAGGAGAAAACAGG - Intronic
1125522591 15:40356476-40356498 CTAGGGAGCTTGGAGACAACTGG - Intergenic
1125769164 15:42153683-42153705 TTTTGGAGCCTTGAAAAAATTGG - Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1126810000 15:52392798-52392820 TCATGGAGCTTGGAGACAAGTGG + Intronic
1129121405 15:73399075-73399097 CTAGGGAGCCAGGAGAAAGCTGG - Intergenic
1130527360 15:84718822-84718844 TTATGGAAGCTGGAGATAAAGGG - Intergenic
1132328897 15:100996551-100996573 ATTTGGAACCTGGAGAAAATGGG - Intronic
1132690225 16:1178771-1178793 TTCTGGAGCTTGGAGGAGACAGG - Intronic
1134536133 16:15028178-15028200 TTCTGGAGCGCGGAGAAGACTGG - Intronic
1140896771 16:79331613-79331635 GTATGGAGCCCAGAGGAAACAGG - Intergenic
1141268470 16:82518233-82518255 TTATATCTCCTGGAGAAAACTGG - Intergenic
1141793972 16:86257047-86257069 GTATGTTGACTGGAGAAAACAGG + Intergenic
1144933298 17:18877539-18877561 TTATGGAGGCCTGAGAAAAGAGG + Intronic
1151411379 17:73932455-73932477 TTCTGTAGCCAGGAGGAAACAGG - Intergenic
1157387254 18:47268079-47268101 TTGTGGTGCCTGTAGAACACAGG + Intergenic
1159203980 18:65226406-65226428 GTTTGGGGCCTGGAGAGAACTGG + Intergenic
1160230516 18:77045141-77045163 TTATGTTGGTTGGAGAAAACTGG + Intronic
1162296199 19:9815437-9815459 TTCTGGAGTCTGGAGAACAGTGG + Intronic
1165326335 19:35116491-35116513 TTCTGGAGCCAGGAGATAAACGG + Intronic
1166874262 19:45887506-45887528 TGCTTGAGCCTGGAGATAACAGG + Intergenic
1167366894 19:49059130-49059152 TTCTGGACCCTGGAGCAAAGGGG - Intronic
927909114 2:26884088-26884110 TTCTGGGGCCTGGAGACAGCTGG + Intronic
928759405 2:34564334-34564356 GGATGCAGCCTGGAGAAAGCTGG - Intergenic
933906803 2:86902120-86902142 TTAGGAAGCCTGGAGAAAAGTGG + Intergenic
934024672 2:87991514-87991536 TTAGGAAGCCTGGAGAAAAGTGG - Intergenic
935083101 2:99817998-99818020 TTCTGGACCCTGGAAATAACTGG + Intronic
935775745 2:106469591-106469613 TTAGGAAGCCTGGAGAAAAGTGG - Intergenic
936365361 2:111849551-111849573 TTAGGAAGCCTGGAGAAAAGTGG - Intronic
938986992 2:136586038-136586060 TTAAGGAGCCTTGAAAAACCTGG + Intergenic
940032841 2:149283259-149283281 CTGTGGAGCCTGATGAAAACAGG + Intergenic
942172327 2:173300290-173300312 TTAAGGAGCCTGGACACAAACGG + Intergenic
943219250 2:185083611-185083633 TTATGTTGCATGGAGTAAACAGG + Intergenic
943465162 2:188219793-188219815 TTATGCAGTCTGGAGAACAGAGG - Intergenic
944426607 2:199590004-199590026 TTATGAAGCCTGTGGATAACTGG + Intergenic
946047538 2:216833602-216833624 GAATGGAGCCTGGAGGAAAGAGG + Intergenic
946939966 2:224760256-224760278 TAATGGAGCTTGGAGCAAAGAGG + Intergenic
948606358 2:239138272-239138294 TTAAGCAGCCTGGAGACAAAGGG + Intronic
1170322249 20:15112920-15112942 TTATCCAGCCTGGAAAAAAAAGG - Intronic
1170610633 20:17909961-17909983 TTCTGGAGGCTGGAGGAGACTGG - Intergenic
1173137114 20:40448108-40448130 TTGTGGAGCCTGGAAAATTCTGG + Intergenic
1173226657 20:41166154-41166176 TGAGGGAGGCTGGGGAAAACAGG - Intronic
1173653799 20:44684924-44684946 TAAGGGAGCCAAGAGAAAACAGG + Intergenic
1173732282 20:45337357-45337379 TTATGGCGTCTGGAGAAGATGGG - Intronic
1174733311 20:52939578-52939600 TTATCAAGCCTCGTGAAAACAGG + Intergenic
1175375953 20:58524187-58524209 TCCTGGAGCTTGGGGAAAACAGG - Intergenic
1175868564 20:62195274-62195296 TTCTGGGGCCTGATGAAAACAGG - Intronic
1176342768 21:5713889-5713911 TGAGTGAGCCTGGAGAAGACAGG - Intergenic
1176421172 21:6517033-6517055 TTTTGGGGCCTTGAGAAAAGAGG + Intergenic
1176475022 21:7146040-7146062 TGAGTGAGCCTGGAGAAGACAGG - Intergenic
1176502059 21:7610567-7610589 TGAGTGAGCCTGGAGAAGACAGG + Intergenic
1176537089 21:8111958-8111980 TGAGTGAGCCTGGAGAAGACAGG - Intergenic
1176883957 21:14231416-14231438 TTATGTAGCATTGAGAACACTGG - Intergenic
1177408363 21:20699214-20699236 TTCTGGTGTCTGGAGAAAAGTGG - Intergenic
1179516170 21:41908579-41908601 TTTTGGAGTCCCGAGAAAACTGG - Intronic
1179696662 21:43125350-43125372 TTTTGGGGCCTTGAGAAAAGAGG + Intergenic
1180880119 22:19197642-19197664 TGATGGTGGCTGGAGAGAACAGG - Intronic
1182564448 22:31186956-31186978 CTCTGGAGCCTAGAGAAGACAGG + Intronic
1183991841 22:41602314-41602336 TTATGGGGCCCTGAGCAAACTGG - Intronic
949741446 3:7239029-7239051 TAATGCAGGCTGGAGAACACTGG + Intronic
949881249 3:8662721-8662743 TGTTGGAGCCTGGGGAAAGCAGG - Intronic
950358968 3:12437068-12437090 TTATGGCGGCTGGAGAAACAGGG - Intergenic
951296646 3:20944424-20944446 TTAAAGAGCCTGGAAAAAATTGG - Intergenic
951854981 3:27186315-27186337 TTATAGACCCAGGAGAAGACAGG + Intronic
953484029 3:43277733-43277755 TTATGGAGCCTGGGCAATATAGG + Intergenic
953911541 3:46895721-46895743 TTATGCTGGCTGGAGAAACCAGG - Exonic
954917555 3:54161977-54161999 GTATGGAGCCTGGTGAATCCTGG + Intronic
955353466 3:58210995-58211017 TTATAAAGCCTGCAGATAACAGG + Exonic
957436448 3:80182996-80183018 TTATGGACCCTGGAGCCACCTGG + Intergenic
960151479 3:114252987-114253009 TAATGGAGCCTGAAAAAAATGGG - Intergenic
960875963 3:122295660-122295682 TTAAGGAACCTGGAGGAGACAGG - Intergenic
962708547 3:138067451-138067473 TTCTGGAGCCTTGAGAAATCTGG + Intronic
963547966 3:146685312-146685334 TTCTGGAGTCTGGAGGAAAGTGG + Intergenic
963815972 3:149831218-149831240 TTCTGGAGTCTGGAGAACAGTGG - Intronic
964044747 3:152309413-152309435 ATATGAGGTCTGGAGAAAACAGG - Intronic
964193593 3:154034875-154034897 AAATGGAGCCTGAAGAAAACAGG + Intergenic
964200875 3:154117824-154117846 TGAAGGAGTCTGGATAAAACTGG - Intergenic
965025070 3:163291551-163291573 TTTTGGGGCCTGGAGGACACTGG + Intergenic
968826267 4:2899936-2899958 TTATGGGGCCTGCAGCACACAGG + Intronic
968972056 4:3801080-3801102 TGATGGAGCCTGGGGAAGGCAGG - Intergenic
970141919 4:12992507-12992529 TTTTGTAGCCTAGGGAAAACAGG + Intergenic
970315419 4:14824523-14824545 TTAAGGAGCCTCCAGAAAACTGG + Intergenic
972071069 4:35019877-35019899 TTATGGGGCCAAGGGAAAACAGG + Intergenic
973221100 4:47729021-47729043 TTACGGAGCCCGCAGAGAACAGG + Intronic
976027639 4:80710117-80710139 TTTTCAAGCCTGGAGACAACTGG - Intronic
976674866 4:87692650-87692672 TTCTGGAGCCTGGAGAATGGTGG - Intergenic
978056272 4:104271800-104271822 GTATGTAGCCTAGAGATAACTGG + Intergenic
984373630 4:178899343-178899365 TTAAGCAGTCTGGAGAACACAGG - Intergenic
986952711 5:13110416-13110438 TCATGAAGTCTGGAGAATACTGG + Intergenic
987873315 5:23647891-23647913 TTCTGGGGTCTGGAGAATACTGG - Intergenic
989152469 5:38313836-38313858 TTATGGTGCATAGAGAAAAATGG - Intronic
989810796 5:45671203-45671225 TAATGGAGTTTGGAGAGAACAGG - Intronic
992938602 5:81738789-81738811 ATATGGAGCATGGAGTAAAGGGG - Intronic
996292268 5:121866242-121866264 TTTTGGAACCTGGAGACAAAGGG - Intergenic
999001643 5:147930126-147930148 TGAAGCAGCATGGAGAAAACCGG - Intergenic
1000116042 5:158154310-158154332 TTTTGGAGTCAGGAAAAAACTGG - Intergenic
1001046702 5:168378922-168378944 GTATGCAGTGTGGAGAAAACAGG + Intronic
1002959711 6:1903731-1903753 TTATCTAGTTTGGAGAAAACAGG - Intronic
1007874583 6:45081855-45081877 TTTTTGAGCCTGGAAAAAATAGG + Intronic
1007942147 6:45791483-45791505 TTAAGCAGCCTGGAAAAAACAGG - Intergenic
1011170588 6:84500285-84500307 TTAAGAATCCAGGAGAAAACTGG - Intergenic
1011227578 6:85124806-85124828 TTAGGGAGGATGGACAAAACTGG + Intergenic
1013275493 6:108580913-108580935 CTCTAGAGCCTGGAGAAAAAAGG - Intronic
1013485898 6:110595694-110595716 TTATGCAGGCTGGAGTATACTGG - Intergenic
1014507104 6:122273106-122273128 TTATAGAGCCAGGAGAAATTGGG + Intergenic
1014731937 6:125042504-125042526 TTTTGGAGCCTTGAGAAAGAAGG + Intronic
1015051204 6:128842526-128842548 TATTGGAGCCTGCTGAAAACTGG + Intergenic
1016270722 6:142286880-142286902 TTATGCAGCCTGGCAAAAATAGG - Intergenic
1016515986 6:144893475-144893497 AAATTCAGCCTGGAGAAAACAGG + Intergenic
1016699619 6:147039378-147039400 TTAAGGAGCCTAGAGAAACGTGG - Intergenic
1017862745 6:158414232-158414254 TGAAGGAGCCTGAAGGAAACTGG - Intronic
1018492008 6:164303470-164303492 TACTGGAACCTGGAGACAACCGG - Intergenic
1018511172 6:164526322-164526344 TTCTGGAGCCTGGAGGAAGGTGG - Intergenic
1021024697 7:15650276-15650298 TTATGGGGTATGGAGAAAAGTGG - Intronic
1022902247 7:34822335-34822357 TCATGGAGCAGGGAGAAACCAGG + Intronic
1024324232 7:48096113-48096135 AAATGAAGGCTGGAGAAAACAGG + Intronic
1024877032 7:54037547-54037569 TTCTGGAGCCTGGAGGACAGTGG + Intergenic
1025813603 7:64890161-64890183 TTTAGGAGCCTGGAGGAAGCAGG + Intronic
1026286403 7:68967055-68967077 CTTTGGAGCCAGAAGAAAACAGG + Intergenic
1028402572 7:90440086-90440108 TCATGGAGCCAGAAGATAACTGG + Intronic
1029011426 7:97265676-97265698 TTATGGAGCTTGCAGTTAACTGG + Intergenic
1034956718 7:155339593-155339615 CTCTGGGGCCTGGAGAAAGCGGG + Intergenic
1036936377 8:13006188-13006210 TGATCCATCCTGGAGAAAACAGG - Exonic
1040036304 8:42873400-42873422 TTATGAAGCCTGGAATAAATAGG - Intronic
1040303810 8:46201844-46201866 TTAAGAAGCATTGAGAAAACAGG + Intergenic
1042356513 8:67834231-67834253 TAATTGACCCTGGAGAAAACAGG + Intergenic
1042509973 8:69600960-69600982 TTATGGAGCCAGTAAAAAAGAGG + Intronic
1043650761 8:82588533-82588555 TTATTAAGCCTGGAAAAGACAGG + Intergenic
1044858268 8:96496841-96496863 TTATGGATCCTGGAGGCAGCTGG + Intronic
1045327563 8:101127870-101127892 GCCTGAAGCCTGGAGAAAACAGG + Intergenic
1046084758 8:109418349-109418371 TTATGAACCCTGAAGAAAATGGG + Intronic
1046559876 8:115822960-115822982 TTATGAGGCATGAAGAAAACAGG - Intergenic
1046902196 8:119535639-119535661 TTATAGAGGCTGGAGAAAAGGGG - Intergenic
1047141482 8:122145500-122145522 TTATAGAGACTGGCTAAAACTGG + Intergenic
1048999534 8:139816013-139816035 TTCCCGAGCCTGGATAAAACTGG + Intronic
1049254842 8:141608314-141608336 ATATGGAGCCTGGACAACAGTGG - Intergenic
1050232468 9:3541511-3541533 TTATAGAAACTGGAGAAAAAGGG + Intergenic
1051936626 9:22449857-22449879 TTAAGAAAACTGGAGAAAACTGG + Intronic
1053117440 9:35517941-35517963 ATATGGAGCTTTGAGAGAACAGG + Intronic
1056054377 9:82805821-82805843 TTAGGGAGCCTGGAAAAAAATGG + Intergenic
1056472718 9:86921326-86921348 TTATGGAGACCTGGGAAAACGGG + Intergenic
1060329884 9:122657992-122658014 TTTTAGAGGCTGGAGAAAATGGG + Intergenic
1061303742 9:129721105-129721127 ACCTGGAGCCGGGAGAAAACAGG + Intronic
1061771180 9:132923347-132923369 TCATGGTGCCTGAAGAAACCAGG - Exonic
1186090213 X:6038707-6038729 TTATGGAGCCTTCAGCAAAGGGG + Intronic
1188930205 X:36099825-36099847 ATTTGAAGCCTGGAGTAAACGGG + Exonic
1189673330 X:43435983-43436005 AAATGAAGCCTGGAGAAAGCTGG + Intergenic
1191883072 X:65861491-65861513 GTATGGCACCTGAAGAAAACTGG + Intergenic
1191951115 X:66594127-66594149 CTATGTAGCCTAGAGAAAAGAGG - Intergenic
1194104940 X:89757268-89757290 TCATGTAGCCGGGAAAAAACTGG + Intergenic
1194518146 X:94884433-94884455 TTATAAAACCTAGAGAAAACAGG - Intergenic
1194999198 X:100625556-100625578 TTATGGAAACTGGGGAAAATGGG - Intergenic
1195145534 X:102011708-102011730 TTATCGAGCCTGGTGATAGCTGG + Intergenic
1198123036 X:133612934-133612956 TTATAGAGACTGGGGAACACCGG + Intronic
1200456904 Y:3405057-3405079 TCATGTAGCCGGGAAAAAACTGG + Intergenic