ID: 911440486

View in Genome Browser
Species Human (GRCh38)
Location 1:97920707-97920729
Sequence GCGGAGCCACAGGCCCGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911440486_911440493 9 Left 911440486 1:97920707-97920729 CCCACGCGGGCCTGTGGCTCCGC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 911440493 1:97920739-97920761 CTCCCCCGCAGAGCTCCCACGGG 0: 1
1: 0
2: 1
3: 25
4: 358
911440486_911440494 10 Left 911440486 1:97920707-97920729 CCCACGCGGGCCTGTGGCTCCGC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 911440494 1:97920740-97920762 TCCCCCGCAGAGCTCCCACGGGG 0: 1
1: 0
2: 1
3: 6
4: 121
911440486_911440492 8 Left 911440486 1:97920707-97920729 CCCACGCGGGCCTGTGGCTCCGC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 911440492 1:97920738-97920760 GCTCCCCCGCAGAGCTCCCACGG 0: 1
1: 0
2: 0
3: 12
4: 170
911440486_911440496 11 Left 911440486 1:97920707-97920729 CCCACGCGGGCCTGTGGCTCCGC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 911440496 1:97920741-97920763 CCCCCGCAGAGCTCCCACGGGGG 0: 1
1: 0
2: 0
3: 22
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911440486 Original CRISPR GCGGAGCCACAGGCCCGCGT GGG (reversed) Intronic
900243749 1:1628543-1628565 GCCGTGCAACAGGCCCACGTGGG + Exonic
900513800 1:3072033-3072055 GCTGAGCCACAGCCCCGGCTTGG - Intronic
900539368 1:3195143-3195165 GCGGAGCCTGAGGCCACCGTGGG + Intronic
904856332 1:33500823-33500845 GAGGAGCCACAGGCCCAGGCTGG + Intergenic
905337479 1:37255525-37255547 GCGAAGCCAGGGGCCCACGTGGG + Intergenic
906213624 1:44026119-44026141 GTTGAGCCACAGGCCAGCCTGGG - Intronic
911440486 1:97920707-97920729 GCGGAGCCACAGGCCCGCGTGGG - Intronic
915472639 1:156135120-156135142 GTGGAGGCACAGGCCTGAGTTGG - Intronic
916770725 1:167904939-167904961 GATGAGCAACAGGCTCGCGTGGG - Intronic
924436589 1:244048650-244048672 GCGGAGCCGCCGGGCCGGGTGGG - Intergenic
1064064505 10:12169491-12169513 TCGGAGTCACAGGCCCGACTCGG - Intronic
1067943303 10:50674755-50674777 GCGCAGCCACAGGCCTGCTCTGG + Intergenic
1074584686 10:114755716-114755738 GCGGAGCCAGAGGCAGGTGTGGG - Intergenic
1075572625 10:123556965-123556987 GCTGAGCCCCAGGCCCGGGAAGG + Intergenic
1077169887 11:1161468-1161490 GCGGAGCCCCCGCCCCACGTGGG + Intronic
1080779564 11:35418569-35418591 GCGGCGCCCCAGGCCCGAGGCGG - Intronic
1083139515 11:60710550-60710572 GCGGTGGCTCAGGCCAGCGTGGG - Intronic
1089045935 11:115502900-115502922 GCGGAGCCCCAGGCCCGGGCGGG - Intronic
1090857827 11:130625754-130625776 CCGGAGCCCCAGTCCCGCCTGGG + Intergenic
1094484258 12:30911867-30911889 GCAGAGCCCCAGGCCTGCCTGGG - Intergenic
1101640322 12:106582414-106582436 GCGGATCCGCAGACACGCGTGGG - Intronic
1104882769 12:132084128-132084150 GCGGAGCCAGAGGCGCGCGCCGG + Intergenic
1108679282 13:52765487-52765509 GTGGAGCCCCAGGCCTGCTTGGG + Intergenic
1114490042 14:23094842-23094864 GCGGATCCAGAGGCTCGCGCTGG + Exonic
1115271843 14:31561495-31561517 GCGGGGCCACTGCCCCGCTTGGG + Exonic
1202918371 14_KI270723v1_random:6020-6042 GCGGAGCCACAGGGGCGCGCGGG - Intergenic
1124584333 15:30991533-30991555 GCGCTGCCACTGGCCCGCGACGG - Exonic
1129108303 15:73323424-73323446 GGGGAGCCACAGGCCCCGGGGGG + Exonic
1129891040 15:79072076-79072098 GAGGAGTCACAGGCCTGCTTTGG + Intronic
1132733782 16:1375753-1375775 GCGGAGCCAAAGGCAGGCCTTGG + Intronic
1133431338 16:5739767-5739789 GGGGAGCCACTGCCCCACGTTGG + Intergenic
1135479888 16:22813973-22813995 ACGGAGCCCCAGGCCAGCTTTGG - Intergenic
1141651778 16:85396717-85396739 GGGAGGCCACAGGCCCCCGTGGG + Intergenic
1142513156 17:410521-410543 GCGGCGCCGCGGGCCCGCGGGGG + Exonic
1144314347 17:14045889-14045911 GGGGAGCCAGATGCCGGCGTGGG - Intergenic
1144328910 17:14206924-14206946 GCGCCGGCACAGGCCCGGGTGGG - Exonic
1144816649 17:18039735-18039757 GCGGAGGCACCGGCCGGCGGGGG - Exonic
1148437117 17:47693822-47693844 GCGGCGCCAGCGGCCCGCGCTGG - Intergenic
1152581991 17:81169672-81169694 GCGCAGCCACAGGCCCAGGAAGG - Intergenic
1152751766 17:82065634-82065656 TCGGAGCCAAAGGCGCGCGGCGG - Intronic
1160134543 18:76261362-76261384 CCGGAGACACAGGCCCCAGTGGG - Intergenic
1161366112 19:3880759-3880781 GCGCAGCCGCAGCCCCGCGCTGG + Exonic
1162725431 19:12687664-12687686 GAGGAGCCACAGGGCCTCCTGGG + Intergenic
1163723618 19:18910218-18910240 CCTGAGCCACAGGCCAGCGTTGG - Intronic
1164402064 19:27909588-27909610 TGGGGACCACAGGCCCGCGTGGG - Intergenic
1166984193 19:46649734-46649756 GCGGAGCGGCGGGCCCGCGCCGG - Exonic
1202647655 1_KI270706v1_random:157091-157113 GCGGTGCCCCCGGCCCGCCTGGG + Intergenic
925051861 2:821740-821762 GCTGAGCCACAGCCACACGTGGG - Intergenic
930593430 2:53356727-53356749 GGGGAGGCTCAGGGCCGCGTGGG - Intergenic
932818065 2:74877453-74877475 GTGAAGCCACAGGCCCGCCATGG - Intronic
937290089 2:120776788-120776810 GAGGAGCCAGAGGGCCGAGTGGG + Intronic
944131718 2:196354133-196354155 CTGGAGCCACAGGCCAGAGTGGG + Intronic
948171982 2:235911294-235911316 ACGGAGCCACAGGCCCCAGGAGG + Intronic
1173828402 20:46062322-46062344 GGGCAGCCACAGGCCCCCATGGG - Exonic
1175956035 20:62609920-62609942 GAGGGGCCACAGGCCAGCGAGGG + Intergenic
1176221220 20:63970052-63970074 GGGGAACCACAGGCCAGCGCCGG - Intronic
1176604205 21:8815669-8815691 GCGGTGCCCCCGGCCCGCCTGGG - Intergenic
1179904174 21:44413647-44413669 GCGGAGGCACGGGCCAGCCTGGG + Intronic
1180346496 22:11707276-11707298 GCGGTGCCCCCGGCCCGCCTGGG - Intergenic
1180354259 22:11825400-11825422 GCGGTGCCCCCGGCCCGCCTGGG - Intergenic
1180383996 22:12166955-12166977 GCGGTGCCCCCGGCCCGCCTGGG + Intergenic
1181182721 22:21078912-21078934 GCTAAGCCACAGGGCAGCGTTGG + Intergenic
1181334298 22:22117043-22117065 CCGCAGCCACAGGGCCTCGTGGG + Intergenic
1181592561 22:23894317-23894339 GCGGAGCCGCAGCCTCGCGGGGG + Exonic
1183688155 22:39373954-39373976 AAGGAGCCACAGGCCCTCCTGGG - Intronic
1184337536 22:43862526-43862548 GCGGAGCCTCCGCCGCGCGTCGG - Intergenic
950447910 3:13048690-13048712 GCGGAATCACAGGCCAGCATGGG - Intronic
968916127 4:3497748-3497770 GCGGAGCCACAGGCAGGCAGGGG + Intronic
969330340 4:6470988-6471010 GCGGAGCCGGAGCCCCGCGGAGG - Intronic
973373913 4:49275280-49275302 GCGGTGCCCCCGGCCCGCCTGGG + Intergenic
973383499 4:49334959-49334981 GCGGTGCCCCCGGCCCGCCTGGG - Intergenic
973387104 4:49519973-49519995 GCGGTGCCCCCGGCCCGCCTGGG - Intergenic
978529920 4:109702992-109703014 GGGGAACGCCAGGCCCGCGTGGG + Intronic
982260149 4:153487742-153487764 GCTCAGCCACAGGCCCACGAGGG - Intronic
982494814 4:156077571-156077593 CAGGAGCCACAGGCCGGAGTGGG - Intergenic
983537918 4:168877978-168878000 GCAGAACCTCGGGCCCGCGTCGG + Intronic
993903021 5:93597025-93597047 GCGGAGGGACAGGCCCCAGTAGG + Intergenic
997613541 5:135231374-135231396 GTGGAGCTAGAGGCCAGCGTAGG + Intronic
1000610161 5:163365178-163365200 CCAGAGCCACAGGCCGGAGTGGG + Intergenic
1006478635 6:34274011-34274033 GCGGACACACAGTCCAGCGTAGG + Intergenic
1015870607 6:137772734-137772756 AAGGAGCCACAGACCCGCATTGG + Intergenic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1019334625 7:477139-477161 GCGGCGCCAGCGGCCCGCGGGGG + Intergenic
1019429253 7:991104-991126 GGGGAGCCCGAGGCCCACGTGGG + Intergenic
1019576270 7:1739158-1739180 GCGGGGCCGCAGGACCGCCTTGG + Intronic
1022508823 7:30922591-30922613 GCGGAGCCAAAGGACCGAGCAGG - Exonic
1029278092 7:99419519-99419541 GCAGTGCCCCAGGCCCGAGTTGG + Exonic
1035581002 8:738846-738868 GCGGAGCCCCCGGACAGCGTAGG + Intergenic
1035727235 8:1832102-1832124 GCGGGGCCACAGGACCCCCTGGG - Intronic
1040296473 8:46151615-46151637 GCTGAGCCACAGGCAGGCCTGGG - Intergenic
1040840563 8:51780226-51780248 GCAGAGCCTCAGGCCCTCCTAGG + Intronic
1049777565 8:144413652-144413674 GCGGAGCCGCAGGCCTGGGGTGG + Intronic
1054351074 9:64017113-64017135 GCGGTGCCCCCGGCCCGCCTGGG - Intergenic
1057356119 9:94332704-94332726 GCGCAGCCACAGGCCCTCTCTGG - Intergenic
1057489135 9:95508318-95508340 GCCGAGCCCCAGGACCGCGGCGG - Exonic
1057651631 9:96924924-96924946 GCGCAGCCACAGGCCCTCTCTGG + Intronic
1203551602 Un_KI270743v1:167766-167788 GCGGTGCCCCCGGCCCGCCTGGG - Intergenic