ID: 911454194

View in Genome Browser
Species Human (GRCh38)
Location 1:98102703-98102725
Sequence ATTCCCCTTAACTACGTAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911454194_911454197 10 Left 911454194 1:98102703-98102725 CCGTTTACGTAGTTAAGGGGAAT No data
Right 911454197 1:98102736-98102758 TCCTGGGCACAATTTAAGACTGG No data
911454194_911454195 -7 Left 911454194 1:98102703-98102725 CCGTTTACGTAGTTAAGGGGAAT No data
Right 911454195 1:98102719-98102741 GGGGAATCTGATTGCATTCCTGG No data
911454194_911454196 -6 Left 911454194 1:98102703-98102725 CCGTTTACGTAGTTAAGGGGAAT No data
Right 911454196 1:98102720-98102742 GGGAATCTGATTGCATTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911454194 Original CRISPR ATTCCCCTTAACTACGTAAA CGG (reversed) Intergenic