ID: 911454195

View in Genome Browser
Species Human (GRCh38)
Location 1:98102719-98102741
Sequence GGGGAATCTGATTGCATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911454190_911454195 2 Left 911454190 1:98102694-98102716 CCTGTGTCTCCGTTTACGTAGTT No data
Right 911454195 1:98102719-98102741 GGGGAATCTGATTGCATTCCTGG No data
911454194_911454195 -7 Left 911454194 1:98102703-98102725 CCGTTTACGTAGTTAAGGGGAAT No data
Right 911454195 1:98102719-98102741 GGGGAATCTGATTGCATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911454195 Original CRISPR GGGGAATCTGATTGCATTCC TGG Intergenic