ID: 911463638

View in Genome Browser
Species Human (GRCh38)
Location 1:98223060-98223082
Sequence CTGTGTTCACAAAGTTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911463638_911463642 17 Left 911463638 1:98223060-98223082 CCCTTTTAACTTTGTGAACACAG No data
Right 911463642 1:98223100-98223122 GAAGCACACTGCTCTTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911463638 Original CRISPR CTGTGTTCACAAAGTTAAAA GGG (reversed) Intergenic
No off target data available for this crispr