ID: 911475286

View in Genome Browser
Species Human (GRCh38)
Location 1:98366371-98366393
Sequence ATGAGCAATACTCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911475286_911475291 10 Left 911475286 1:98366371-98366393 CCTTCCACCTGAGTATTGCTCAT No data
Right 911475291 1:98366404-98366426 CTCATTCTGCCCACTCAGCCTGG 0: 14
1: 51
2: 119
3: 167
4: 479
911475286_911475292 14 Left 911475286 1:98366371-98366393 CCTTCCACCTGAGTATTGCTCAT No data
Right 911475292 1:98366408-98366430 TTCTGCCCACTCAGCCTGGCAGG 0: 31
1: 79
2: 154
3: 235
4: 558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911475286 Original CRISPR ATGAGCAATACTCAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr