ID: 911476272

View in Genome Browser
Species Human (GRCh38)
Location 1:98377284-98377306
Sequence CTGCAGATACTGAGGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911476272_911476277 -8 Left 911476272 1:98377284-98377306 CCATTGTCCCTCAGTATCTGCAG No data
Right 911476277 1:98377299-98377321 ATCTGCAGGGAATTGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911476272 Original CRISPR CTGCAGATACTGAGGGACAA TGG (reversed) Intergenic
No off target data available for this crispr