ID: 911498005

View in Genome Browser
Species Human (GRCh38)
Location 1:98654137-98654159
Sequence CACGAACTAAGTGGCTATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911498005_911498009 8 Left 911498005 1:98654137-98654159 CCACTATAGCCACTTAGTTCGTG No data
Right 911498009 1:98654168-98654190 AAACAAAGAATATAATGGCTAGG No data
911498005_911498010 9 Left 911498005 1:98654137-98654159 CCACTATAGCCACTTAGTTCGTG No data
Right 911498010 1:98654169-98654191 AACAAAGAATATAATGGCTAGGG No data
911498005_911498011 16 Left 911498005 1:98654137-98654159 CCACTATAGCCACTTAGTTCGTG No data
Right 911498011 1:98654176-98654198 AATATAATGGCTAGGGAGAAAGG No data
911498005_911498008 3 Left 911498005 1:98654137-98654159 CCACTATAGCCACTTAGTTCGTG No data
Right 911498008 1:98654163-98654185 ACATCAAACAAAGAATATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911498005 Original CRISPR CACGAACTAAGTGGCTATAG TGG (reversed) Intergenic
No off target data available for this crispr