ID: 911498266

View in Genome Browser
Species Human (GRCh38)
Location 1:98656783-98656805
Sequence CCTCATCTGTAAAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911498260_911498266 29 Left 911498260 1:98656731-98656753 CCACTTATTACTTACCTTGGGTA No data
Right 911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
911498259_911498266 30 Left 911498259 1:98656730-98656752 CCCACTTATTACTTACCTTGGGT No data
Right 911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
911498261_911498266 15 Left 911498261 1:98656745-98656767 CCTTGGGTAAATTACTAAACTTC No data
Right 911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911498266 Original CRISPR CCTCATCTGTAAAATGGGGA TGG Intergenic
Too many off-targets to display for this crispr