ID: 911500140

View in Genome Browser
Species Human (GRCh38)
Location 1:98675568-98675590
Sequence ATGTAGTAGGTAAAAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911500135_911500140 28 Left 911500135 1:98675517-98675539 CCCACTCCACAAAAGGATGCATT 0: 1
1: 0
2: 0
3: 9
4: 173
Right 911500140 1:98675568-98675590 ATGTAGTAGGTAAAAGAAGTAGG 0: 1
1: 0
2: 2
3: 32
4: 260
911500136_911500140 27 Left 911500136 1:98675518-98675540 CCACTCCACAAAAGGATGCATTT 0: 1
1: 0
2: 1
3: 15
4: 228
Right 911500140 1:98675568-98675590 ATGTAGTAGGTAAAAGAAGTAGG 0: 1
1: 0
2: 2
3: 32
4: 260
911500137_911500140 22 Left 911500137 1:98675523-98675545 CCACAAAAGGATGCATTTCAAGC 0: 1
1: 0
2: 2
3: 10
4: 164
Right 911500140 1:98675568-98675590 ATGTAGTAGGTAAAAGAAGTAGG 0: 1
1: 0
2: 2
3: 32
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911500140 Original CRISPR ATGTAGTAGGTAAAAGAAGT AGG Intronic
900980805 1:6045126-6045148 GTGTGGAAGGTAAATGAAGTGGG - Intronic
903725018 1:25435018-25435040 ATGTGGTAAGTAGAAGAAGGAGG + Intronic
903970060 1:27112960-27112982 AGGTGATAAGTAAAAGAAGTTGG - Intronic
905756115 1:40510556-40510578 ATGTTGTATGTAAAACAAGTAGG + Intronic
905766707 1:40607537-40607559 ATGCAGCAGGTGGAAGAAGTAGG - Intergenic
906433917 1:45778865-45778887 ATGAAGTAGGTCAAATAAATGGG + Intergenic
906876412 1:49543384-49543406 TTGTTGTAGGTAAAAGAAACAGG + Intronic
907941498 1:59092576-59092598 ATCTAGTAAGTGAAGGAAGTGGG - Intergenic
908364966 1:63412126-63412148 ATGTAGAAGGTACAAGGAATAGG + Intronic
908676131 1:66606101-66606123 ATGTAGTAGGAAAAAATACTAGG + Intronic
908708839 1:66992292-66992314 ATGTAGAAAGTAAAGGCAGTTGG - Intergenic
909426033 1:75526215-75526237 ATGGAGGAGGTAGAAGAAGGTGG - Intronic
909572454 1:77131390-77131412 ATGGAGTAAGGAAAAGAAATAGG - Intronic
910878611 1:91902200-91902222 ATGGAGGAGTGAAAAGAAGTAGG - Intronic
911500140 1:98675568-98675590 ATGTAGTAGGTAAAAGAAGTAGG + Intronic
911643864 1:100318308-100318330 ATGCAGTAGGTTAAAGAAAAAGG + Intergenic
914682711 1:149950569-149950591 CTGTAGTATATAAAATAAGTAGG - Intronic
915198190 1:154206142-154206164 ATGTAGTTAGTAACAGGAGTGGG - Intronic
916156639 1:161856281-161856303 CTATAGTAGGTGAAAAAAGTTGG - Intronic
917040429 1:170800176-170800198 ATGGAGTAGGTAGAGGAAGTGGG - Intergenic
917356850 1:174134602-174134624 ATATAGTAGGTAACAGAATATGG + Intergenic
918417855 1:184330850-184330872 GAGTAGAAGGTAAAAGAATTGGG + Intergenic
918636534 1:186781072-186781094 ATTTAGTATGTAGAAGATGTAGG - Intergenic
919660197 1:200236673-200236695 ATGTAGAAGGTACAAGCAGCAGG - Intergenic
922660660 1:227427691-227427713 ATGAAGTAGGTGGAAGAAGAAGG - Intergenic
922943011 1:229484578-229484600 ATGTTGTAAGTAAAATAATTTGG + Intronic
1065368660 10:24959432-24959454 ATGGAGAAAGTAAAAGAAATTGG + Intergenic
1066315461 10:34241549-34241571 CTGTAGTAGGCAAAAGAAGAAGG + Intronic
1066659385 10:37726011-37726033 AGGCAGTTGGGAAAAGAAGTTGG - Intergenic
1067122808 10:43489129-43489151 ATGTAGTATCTCCAAGAAGTTGG - Intergenic
1068123946 10:52814770-52814792 AAGTAGAAGGAAAAAGAAGAAGG - Intergenic
1068895167 10:62190882-62190904 AAATTGTAGGTAAAACAAGTAGG - Intronic
1069003633 10:63293420-63293442 AAGTGGTAAGTAAAAGAAGTAGG - Intronic
1075769531 10:124921553-124921575 ATGTAGTAGGTAAGTCAAGATGG - Intergenic
1078360681 11:10665353-10665375 GTGTATTAGTAAAAAGAAGTGGG - Intronic
1079816871 11:25072111-25072133 AATTAGTAGGTGAAAGAACTGGG + Intronic
1080665325 11:34330926-34330948 ATGAAGTTGTTAAAAGAAGTTGG - Intronic
1081079089 11:38716988-38717010 ATATAGTATATAAAAGATGTAGG - Intergenic
1081189604 11:40087156-40087178 AAGTAGTAAATAAAAGGAGTTGG - Intergenic
1085419733 11:76345655-76345677 ATATAGGAGGTCAAAGAGGTAGG - Intergenic
1085419738 11:76345707-76345729 ATATAGGAGGTCAAAGAGGTAGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087648383 11:100834665-100834687 TAGTAGTAGCTTAAAGAAGTGGG + Intronic
1088212638 11:107473544-107473566 ATAAAGTAGGTAGAAGAAGGTGG - Intergenic
1088402713 11:109438854-109438876 AGCTAGTAGGTAATGGAAGTGGG - Intergenic
1088616094 11:111630192-111630214 ATGTGCTAAGTAAAAGAAGCTGG + Intronic
1089728401 11:120503452-120503474 GTGTAGTTGGCTAAAGAAGTGGG - Intergenic
1091794676 12:3291210-3291232 AAGCAGGAGGAAAAAGAAGTAGG + Intergenic
1092896099 12:13012034-13012056 ATATATTAGGTTAAAGAAGTAGG - Intergenic
1095923679 12:47557201-47557223 ATGTAATAGATAAAAGCAGAGGG + Intergenic
1097325852 12:58276320-58276342 ATGTAGTAGTATTAAGAAGTGGG + Intergenic
1098139958 12:67441306-67441328 TTTGAGGAGGTAAAAGAAGTAGG + Intergenic
1099162323 12:79257904-79257926 ATATAGTGGGTTAAAAAAGTAGG + Intronic
1099173503 12:79393878-79393900 ATGGAGTGGGGAAAAGAAGAGGG - Intronic
1099598956 12:84706928-84706950 ATGCAGTAGGGATAAGAAGCAGG + Intergenic
1101848746 12:108385553-108385575 ATTTAGTAGGCAAACAAAGTAGG + Intergenic
1105376718 13:19852530-19852552 CTGTAGTAGGTAAAAGCATATGG - Intronic
1105755386 13:23458958-23458980 AGGGAGTAAGTAAGAGAAGTAGG - Intergenic
1106355327 13:28976654-28976676 ATTTAGAAGTTAAAATAAGTAGG + Intronic
1108603353 13:52013228-52013250 ATGTAGGTGGTAAAAAAACTAGG - Intronic
1110549527 13:76796720-76796742 ATATAGTAGGAAAAGGAAGCAGG - Intergenic
1113162645 13:107399589-107399611 ATTTTGTAGGTAAAAGGATTAGG - Intronic
1115711214 14:36053368-36053390 TTTTTGTAGGCAAAAGAAGTAGG + Intergenic
1119314869 14:73684947-73684969 ATGTTGGAGGTTACAGAAGTGGG - Intronic
1123891678 15:24786759-24786781 ATGCAGAAGGTAAAAGGACTTGG + Intergenic
1123895043 15:24820347-24820369 AGGTAGAAGGTAAATGAAATGGG + Intergenic
1124546549 15:30632857-30632879 AGATAGTAGATAAAAGAAGGTGG + Intronic
1124780151 15:32622859-32622881 AGATAGTAGATAAAAGAAGGTGG + Intronic
1125195600 15:37042381-37042403 ATGGGGTAAGTAGAAGAAGTTGG - Intronic
1125925955 15:43563365-43563387 AGGTAGTAGGTAAAAGAAAAAGG - Intronic
1125939099 15:43662916-43662938 AGGTAGTAGGTAAAAGAAAAAGG - Intronic
1127886207 15:63203290-63203312 ATGGTGTAGCTAAAAGAACTTGG + Intronic
1128440809 15:67706826-67706848 ATGTGATAGGGAAGAGAAGTAGG + Intronic
1130174476 15:81554081-81554103 ATGCAGAAGGGAAAAGAAATAGG - Intergenic
1131803628 15:96098951-96098973 GTGGAGGAGGTAAAAGAAGATGG - Intergenic
1132231284 15:100186130-100186152 ATGAAGTATGTGAAGGAAGTAGG + Intronic
1132281819 15:100624085-100624107 ATGTGGAAGCTAAAAAAAGTTGG + Intronic
1135212811 16:20538564-20538586 ATGTAGTTGGTGAAAGGAGGGGG + Intronic
1136362946 16:29793022-29793044 ATGTGGGAGGTAAGAGACGTTGG + Intronic
1137706755 16:50540760-50540782 GTGGAGGAGGTAAAAGAAGTTGG - Intergenic
1137877981 16:52015484-52015506 ACTTAGTAGGGAAAAGAAGGAGG + Intronic
1137997272 16:53232177-53232199 ATTTAGAAGGTAAAAGGAATGGG - Intronic
1138317797 16:56085337-56085359 CTTTAGTACGAAAAAGAAGTGGG + Intergenic
1139025931 16:62817803-62817825 AAGCTGTAGATAAAAGAAGTTGG + Intergenic
1141941885 16:87282258-87282280 GTGTAGTGGGGAAAAAAAGTGGG + Intronic
1142616756 17:1141037-1141059 ATGATGTAGGTTAAAGAACTGGG + Intronic
1144169704 17:12648082-12648104 AAGTGGTATGTAAAAGAAGAAGG - Intergenic
1144190158 17:12838242-12838264 ATATAGTAAGAAAAAAAAGTAGG + Intronic
1144760993 17:17707313-17707335 ATGTAGTGAGAAAAAAAAGTAGG + Intronic
1146700185 17:34951258-34951280 ATATATTAGGTAAAAGCAGGGGG + Intronic
1149446049 17:56714232-56714254 AGGTAGTTGGGAAAAGAAGATGG + Intergenic
1150964297 17:69950223-69950245 ATTTAGCAAGTAAAAGAAGGGGG - Intergenic
1153406103 18:4741571-4741593 AAGTAGTAGGTAGATGAATTGGG - Intergenic
1153647448 18:7207852-7207874 ATGTAGTATTAAAAAAAAGTGGG - Intergenic
1153713582 18:7823597-7823619 ATAAAGCAGGCAAAAGAAGTTGG + Intronic
1154219057 18:12436131-12436153 ATGCAGAAGGTATAAGCAGTGGG - Intergenic
1154929435 18:20976976-20976998 AAGTAGGAAGTAAAAGAAGTAGG - Intronic
1155622344 18:27794228-27794250 ATGTTGTAAGTAGAAGAATTTGG + Intergenic
1155650820 18:28139377-28139399 TGGTAGTTGGTAAGAGAAGTGGG - Intronic
1155891827 18:31279751-31279773 ATGTAGCAGGGAAGAAAAGTGGG - Intergenic
1159308043 18:66671438-66671460 ATGTGGTTGGTAAAATAATTAGG + Intergenic
1160305172 18:77726667-77726689 TAGTAGTAGGAAAAAGAAATGGG + Intergenic
1161277408 19:3426420-3426442 ATGTTGTAGGGATAGGAAGTGGG + Intronic
1162008577 19:7796417-7796439 GTGTAGTAGGTATAGGTAGTAGG + Intergenic
1166494441 19:43288735-43288757 ATGAAGTAGCCAAAAGAAATAGG - Intergenic
925791373 2:7490625-7490647 ATGTAATAGGAAAAAGAATGGGG - Intergenic
928819945 2:35349131-35349153 ATGTAGTAGATAAAATACCTGGG - Intergenic
929029133 2:37634678-37634700 ATTTAGGAGGCAAAAGAAGAGGG + Intergenic
930659321 2:54038080-54038102 ATGAAGTAGGAAAAACAAGCTGG + Intronic
930788046 2:55291693-55291715 ATGTAGTGGGTAATAGAATTAGG + Exonic
932889285 2:75577928-75577950 AGGTAGAAGGTGAATGAAGTTGG + Intergenic
932919177 2:75890316-75890338 ATGTAGAAAGTAAAAGAGGATGG + Intergenic
933042229 2:77483777-77483799 ATCTAATAGGTAGATGAAGTTGG - Intronic
933066206 2:77801215-77801237 ATATTCTATGTAAAAGAAGTAGG - Intergenic
935126907 2:100232300-100232322 ATGAAATAGTTAAAAGATGTTGG - Intergenic
937383065 2:121399148-121399170 ATGTAGTAAAATAAAGAAGTAGG + Intronic
937528724 2:122802595-122802617 ATGTAGTAGTTAAAATAATGAGG + Intergenic
938227715 2:129630349-129630371 AAGTAGTAGGTAGAGGAACTTGG - Intergenic
939237196 2:139510811-139510833 ATGTAGTAGCTTAAAGATGTTGG + Intergenic
939429502 2:142084657-142084679 ATGTTATTGGTAAAAGTAGTTGG - Intronic
939805327 2:146768740-146768762 ATAGAGAAGGTAAAAGAAGATGG - Intergenic
939842698 2:147207814-147207836 ATCTAGTAGGTAAAAGAACAGGG + Intergenic
939866606 2:147480079-147480101 CTGTGGTAGGGAAGAGAAGTTGG - Intergenic
942145661 2:173023970-173023992 AGGTCCTAGGTAAAAAAAGTTGG - Intronic
942382625 2:175407771-175407793 ATTTAGTAGATAAAAGAATATGG - Intergenic
943354998 2:186843513-186843535 ATGTAGGATGTAAAACAAGCAGG + Intronic
943506415 2:188765550-188765572 CTGAAGTTGGTAAAAGATGTAGG - Intronic
944780523 2:203012824-203012846 ATGTTGGAGGAAAATGAAGTAGG + Intronic
945618982 2:212109473-212109495 AAGTAATAGCTGAAAGAAGTGGG - Intronic
945690297 2:213025820-213025842 AGGTAGAAGGTAACAGAAGTGGG - Intronic
946479701 2:220042631-220042653 ATATATTAGGTGAAAGGAGTAGG - Intergenic
947943870 2:234082998-234083020 AGGATGTAGGTAAGAGAAGTGGG + Intergenic
1170202081 20:13755172-13755194 ATGGAGTAAGGAAGAGAAGTTGG + Intronic
1170618677 20:17976009-17976031 TTGTGCTAGGTAAAAGAATTGGG + Intronic
1172220518 20:33271467-33271489 ATGTAGTAGGAAAATTAAATGGG + Intergenic
1172410431 20:34717923-34717945 ATGTGGCTGGGAAAAGAAGTGGG + Intronic
1173544900 20:43888595-43888617 ATGCAGTGGGTAAAAGAAAAAGG - Intergenic
1174915780 20:54652421-54652443 ATTTAATAGGTAAAAGATCTTGG - Intergenic
1175298475 20:57926091-57926113 ATGTAGAAGGTAAAACAATAAGG - Intergenic
1176672212 21:9745194-9745216 AGGGAGGAGGGAAAAGAAGTGGG + Intergenic
1178740935 21:35200500-35200522 ATGTCTTATGTAAAAGAAATGGG - Intronic
1179250724 21:39669214-39669236 CTGAATGAGGTAAAAGAAGTTGG + Exonic
1180578761 22:16809041-16809063 AAGTAGTAGTTAAAAAAAGTGGG + Intronic
1181840332 22:25652944-25652966 GTGTAGTAGGTATACGATGTAGG + Intronic
1185376629 22:50485607-50485629 ACGTAGAAGGTAGAATAAGTGGG + Exonic
952697578 3:36286989-36287011 ATGTGGAAGCTAAAAAAAGTTGG + Intergenic
953376006 3:42429104-42429126 ATGTAGCAATTAAAACAAGTAGG + Intergenic
953898748 3:46825646-46825668 ATGTAGGAAAGAAAAGAAGTTGG + Intergenic
955713043 3:61800400-61800422 GTTTAGTAGGTACAAGAACTTGG + Intronic
956403101 3:68900783-68900805 ATTTATTAGGTAAAGGAAATGGG - Intronic
956484148 3:69703733-69703755 TTGTAGAATGTCAAAGAAGTGGG + Intergenic
958994898 3:100893071-100893093 ATAAAGCAGGCAAAAGAAGTTGG + Intronic
959109045 3:102099604-102099626 AAGTTGTAGGTAAAAAAAGTAGG - Intronic
959394625 3:105821788-105821810 AGGTAGGAGGGAAAAGAAGTTGG - Intronic
959466746 3:106697346-106697368 ATGTGTTAGGAAAAAGAACTGGG - Intergenic
959612108 3:108306694-108306716 ATGTAGTATGTTAAAAAAGTTGG - Intronic
960325622 3:116292122-116292144 ATGAAATAAATAAAAGAAGTAGG - Intronic
960373724 3:116872701-116872723 ATGAAGCAGGAGAAAGAAGTCGG + Intronic
960438394 3:117655997-117656019 ATTTAGTAAGTAAAAGATGTAGG + Intergenic
960994330 3:123331046-123331068 AAATAGTAGGAAAGAGAAGTGGG + Intronic
961112311 3:124295351-124295373 ATGTAGGAGGCAAAATCAGTTGG + Intronic
961980470 3:131072743-131072765 ATATTGTAGGTAAAAGAAGAGGG + Intronic
962957212 3:140277140-140277162 ATTTATGAGGAAAAAGAAGTAGG + Intronic
962957312 3:140278213-140278235 ATTTATGAGGAAAAAGAAGTAGG + Intronic
963299277 3:143580905-143580927 ATTTAATAGGTATAGGAAGTGGG + Intronic
963338466 3:144004374-144004396 GTATAGTAAATAAAAGAAGTGGG + Intronic
963341190 3:144035689-144035711 AGGAAGTAGGTAAAATAAGAAGG - Intronic
964148305 3:153493116-153493138 ATGTGGAAGTTAAAAAAAGTTGG + Intronic
964288744 3:155151909-155151931 AGGTGGTTGGTAAAAAAAGTAGG - Intronic
964534622 3:157706126-157706148 ATGTAGTAGGCACAATAAATTGG - Intergenic
965517414 3:169636425-169636447 ATGTAATAGAAAAAAGAAATAGG + Intronic
965635231 3:170773913-170773935 ATGTAGTGGGGGAAAGAGGTTGG + Intronic
966450089 3:180049261-180049283 ATCTAGTAGGTATAAGAGCTGGG - Intergenic
966579166 3:181540241-181540263 AATTAGTAAGTAAAAGAATTTGG - Intergenic
967337041 3:188356201-188356223 TTTTAGTAGGAAAAAGAAGTTGG - Intronic
968010879 3:195273779-195273801 ATCTATTAAGTGAAAGAAGTGGG + Intergenic
968242246 3:197100977-197100999 ATCTAGTAGGGAAAGGAAGGAGG - Intronic
968769150 4:2492766-2492788 AGGTGGGAGGTCAAAGAAGTGGG - Intronic
971419364 4:26461342-26461364 ATGTAGTAGGGAAAGAATGTTGG + Intergenic
972036489 4:34529018-34529040 AGGTATTAGGTAAAGGAAGAGGG + Intergenic
972944304 4:44235691-44235713 ATGTACTACTTAAAATAAGTTGG - Intronic
973598522 4:52517083-52517105 ATGTAAAAGGTAAAATAAGAAGG + Intergenic
974118855 4:57613480-57613502 TTGTAGTAGGTAATAGAAGTGGG + Intergenic
974241877 4:59259700-59259722 ATGAATTTGGAAAAAGAAGTTGG + Intergenic
975942582 4:79664733-79664755 ATTAAGTAGATAAAACAAGTCGG - Intergenic
976882972 4:89952239-89952261 ATGTATTAAGTAAAACAAGATGG + Intronic
977817145 4:101427801-101427823 ATAGAGTAGGTATAAGAATTGGG - Intronic
978727811 4:111990819-111990841 AGCTAGGAAGTAAAAGAAGTTGG + Intergenic
978797842 4:112725963-112725985 ATGAAGAAGATAAAACAAGTAGG + Intergenic
978861265 4:113451904-113451926 AAGAAGTCGGGAAAAGAAGTAGG + Intronic
979397491 4:120206132-120206154 ATGTAGTATGTGAAAGAAAGAGG + Intergenic
979516045 4:121611508-121611530 ATGCAGTAGTAAAAAGAAATGGG + Intergenic
979539476 4:121865105-121865127 ATGTGGAAGCTAAAAAAAGTTGG - Intronic
981050723 4:140306771-140306793 ATGTTGTAGGTAGGAGAAGGTGG + Intronic
981671265 4:147289676-147289698 ATCTAATATGTAAAACAAGTTGG + Intergenic
983139892 4:164136856-164136878 ATGTAGTATGGAAGAGAAGAGGG + Intronic
983459529 4:168010970-168010992 ATAAAGCAGGTAGAAGAAGTTGG + Intergenic
983875930 4:172874536-172874558 ATGTTTTATGTAAGAGAAGTTGG + Intronic
985246433 4:187984057-187984079 ATGTAGTATCTCAAATAAGTGGG - Intergenic
985402521 4:189606654-189606676 AGGGAGGAGGGAAAAGAAGTGGG - Intergenic
987266116 5:16256748-16256770 ATGTTGTATGCAGAAGAAGTAGG + Intergenic
987785724 5:22496070-22496092 ATGTTGTAGGTGAAAGAAATGGG + Intronic
988777905 5:34493717-34493739 ATATGGCAGTTAAAAGAAGTGGG + Intergenic
988874633 5:35430368-35430390 ATGTTGTAGTAAACAGAAGTAGG - Intergenic
989706245 5:44334440-44334462 ATGTAGTTGGGATAAGAAGGTGG - Intronic
992417863 5:76569635-76569657 TTGTAGAAGGTAACAGAAGGTGG + Intronic
993329896 5:86586314-86586336 ATATAGGAGGTAAGAGAATTGGG - Intergenic
993516806 5:88846701-88846723 ATGCAGTAGAAAAAAGAAGAAGG - Intronic
993778503 5:92034211-92034233 ATGTAGCATGTAAAACAAATGGG - Intergenic
994076419 5:95655479-95655501 ATGTAGTAGGTCTAAGGGGTTGG - Intronic
994255304 5:97586654-97586676 ATGTAGAAGAACAAAGAAGTTGG + Intergenic
995953371 5:117744150-117744172 ATGTAGGAGCTAAAAAAAATTGG - Intergenic
997650920 5:135519682-135519704 AAGTAGATGGTAAAAGAAGAGGG - Intergenic
998495224 5:142582583-142582605 CTGTAGTATGGAAAAGAAGATGG - Intergenic
998858345 5:146417812-146417834 TTGTAGTAGGTATTAGAACTTGG + Intergenic
1001173960 5:169447521-169447543 CTCTATTAGGTATAAGAAGTGGG - Intergenic
1001738009 5:174022871-174022893 ATGTAGGAGGAAGAAGGAGTTGG + Intergenic
1003841269 6:10122859-10122881 ATGTGATAAGTAAAAGAAGCTGG - Intronic
1004741103 6:18462120-18462142 GGGTAGTAAGGAAAAGAAGTAGG - Intronic
1004989786 6:21124559-21124581 AAGTAGTGGGTAAAGGGAGTGGG - Intronic
1005211032 6:23463781-23463803 ATGGAATAGGTAAAAGGGGTTGG + Intergenic
1006301712 6:33196807-33196829 GTGAGGTAGGTAAAAGAATTAGG + Intronic
1007803782 6:44421346-44421368 ATGTAGTAGGAAAATGGAATTGG + Intronic
1009315148 6:62209733-62209755 ATAAAGTAGGCAGAAGAAGTTGG + Intronic
1009894418 6:69729468-69729490 AGGTAGGAGGAAAAAGAATTGGG - Intronic
1010581952 6:77610189-77610211 ATGTAGTATGTAAGAGAAAGAGG + Intergenic
1011830174 6:91362839-91362861 ATGAAGCAGGCAGAAGAAGTTGG + Intergenic
1015467665 6:133565675-133565697 ATGTTTTAAGAAAAAGAAGTGGG + Intergenic
1016828072 6:148406352-148406374 AAGTCGTAGATAAAAGCAGTTGG + Intronic
1017239833 6:152155744-152155766 ATTTAGTTGGGAAAATAAGTAGG - Intronic
1018448710 6:163884448-163884470 ATGTGGAAGTTAAAAAAAGTTGG + Intergenic
1018607355 6:165611951-165611973 ATGAAGTGTGTAAAAGAAGCAGG - Intronic
1020700400 7:11474779-11474801 ATGTAGTAGGGAAAAGTAGTAGG + Intronic
1021021871 7:15609997-15610019 ATGTAGTAAGAAAATGAAATAGG - Intergenic
1021673799 7:23060253-23060275 ATTTAGTACTAAAAAGAAGTGGG - Intergenic
1022599631 7:31745396-31745418 ATATAGTATGAAAAAGAAATGGG + Intergenic
1026771334 7:73201999-73202021 TTGTAGTACGTAAATGACGTGGG + Intergenic
1027012200 7:74755396-74755418 TTGTAGTACGTAAATGACGTGGG + Intronic
1027075840 7:75190658-75190680 TTGTAGTACGTAAATGACGTGGG - Intergenic
1027541174 7:79468047-79468069 ATGTATTAGTTATAAGAAGTTGG - Intergenic
1027541177 7:79468098-79468120 ATGTATTAGTTATAAGAAGTTGG - Intergenic
1027543344 7:79495952-79495974 ATGTGGAATGTAAAAAAAGTTGG - Intergenic
1029027026 7:97427697-97427719 ATGCAGTAGATGAAAGAAGTAGG + Intergenic
1029102322 7:98142166-98142188 AAGAAGTAGGTTCAAGAAGTAGG + Intronic
1030353725 7:108520360-108520382 ATGTAGGAGCTAAAAAAAATTGG + Intronic
1030748927 7:113205353-113205375 ATGGAGTGGGTAATACAAGTGGG + Intergenic
1031130873 7:117832082-117832104 ATGTGGGAGGTAAAAGGTGTGGG - Intronic
1031386720 7:121160756-121160778 CTGTAGAAGGTAGAAGAAATGGG + Intronic
1034784429 7:153912458-153912480 ATGTAATAGGAAAGAGAATTTGG - Intronic
1035429757 7:158810376-158810398 ATCTAGTAAGTGAAAGAAGTGGG + Intronic
1035539541 8:422106-422128 ATCTAACAGGTAAAAGAATTAGG + Intronic
1037998207 8:23368597-23368619 AGGCAGTAGGTAAAGGAGGTGGG - Intronic
1038554982 8:28504558-28504580 ATGTAGTAGGTTTAAGACTTTGG + Intronic
1038832267 8:31074669-31074691 ATCAGGTAGGTAAAAAAAGTGGG + Intronic
1039660302 8:39454634-39454656 ATGTAGAAGGTAAGAAAAATTGG - Intergenic
1039795460 8:40909117-40909139 ATTTGGAAGGTAAAAGATGTTGG - Intergenic
1041415243 8:57600733-57600755 ATGTGGGAGCTAAAAAAAGTTGG + Intergenic
1041522369 8:58770638-58770660 AGCTAGTAGGTGAAGGAAGTAGG + Intergenic
1043062936 8:75528153-75528175 ATGTAGTAGGTAGAAAATGAGGG + Intronic
1043439419 8:80263834-80263856 AAGAACTAGGTAAGAGAAGTGGG + Intergenic
1044262371 8:90140896-90140918 ATGTAGAAGTTAAATCAAGTAGG - Intergenic
1045217237 8:100160684-100160706 GTGTAGTAGGGAGAAGAAGTAGG + Intronic
1045226306 8:100249482-100249504 AAGTAGTAAGTGAAAGAAGTGGG + Intronic
1046655532 8:116890040-116890062 ATGTAGAAAGCAAATGAAGTTGG - Intergenic
1048836487 8:138523892-138523914 ATGTGGTATTTAAAAGGAGTGGG + Intergenic
1050153889 9:2645074-2645096 AGGCAGTAGGTAAATGAACTTGG + Exonic
1050658221 9:7852951-7852973 ATAAAGTAGGCAGAAGAAGTTGG - Intronic
1051137249 9:13936148-13936170 ATTTAGTAGGTAAAGTAAGGAGG - Intergenic
1052676892 9:31637775-31637797 GTGAGGTAAGTAAAAGAAGTAGG - Intergenic
1052747309 9:32453036-32453058 AAGAACCAGGTAAAAGAAGTTGG - Exonic
1052879297 9:33591013-33591035 GGGTAGAAGGAAAAAGAAGTGGG + Intergenic
1053084810 9:35209751-35209773 ATGATGTAGGGAAAAGAAGGGGG - Intronic
1053496681 9:38553205-38553227 GGGTAGAAGGAAAAAGAAGTGGG - Intronic
1055719647 9:79157525-79157547 ATGGAGTGGGTATAGGAAGTTGG + Intergenic
1056087991 9:83173327-83173349 ATGTAGTGAGAAAAAGAAGTTGG - Intergenic
1057157191 9:92853363-92853385 ATGTAGCATGTAAAAGCAGGTGG - Intronic
1057978664 9:99635215-99635237 ATGTAGCCTGTAACAGAAGTGGG - Intergenic
1058387581 9:104456797-104456819 TTTTAGAAGGTAAAATAAGTAGG - Intergenic
1059267063 9:113044429-113044451 ATGTTGTAGTAAAAAGAGGTGGG + Intronic
1187237503 X:17482033-17482055 AGGTGGTAGGTAACAGAAGCAGG - Intronic
1187713456 X:22077332-22077354 AGGGAGTAGGTAAAAGAGGTGGG - Intronic
1188021613 X:25164701-25164723 AGATAATAGATAAAAGAAGTAGG - Intergenic
1188102932 X:26112975-26112997 ATGTAGTATATAGAAGAGGTAGG - Intergenic
1188324620 X:28785644-28785666 ATGTATTAGGAAAAACAAGAAGG - Intronic
1189023317 X:37365228-37365250 ATTTATTGGGTAAAAGAAATAGG + Intronic
1191096744 X:56681099-56681121 ATAAAGCAGGTAGAAGAAGTTGG - Intergenic
1193892474 X:87067368-87067390 ATGTAGCAGCTAAAAGAATGAGG + Intergenic
1194422561 X:93695113-93695135 TTGCAGTTGGTAAAAGAACTAGG + Intronic
1194435727 X:93867248-93867270 ATGGAGTCCATAAAAGAAGTAGG + Intergenic
1197452574 X:126638397-126638419 GTGTACTAGGTAAAAGAAATTGG + Intergenic
1198769828 X:140118644-140118666 ATGTCATAGGAAAAAAAAGTTGG - Intergenic
1201347107 Y:12996938-12996960 GTGTAGTAGGTATAAGCAGTAGG + Intergenic
1201396457 Y:13554162-13554184 ATGTAAAAGGGAAAAGAATTGGG - Intergenic
1202329144 Y:23727849-23727871 AAGTAGTAGTTTAAAAAAGTGGG + Intergenic
1202541627 Y:25942205-25942227 AAGTAGTAGTTTAAAAAAGTGGG - Intergenic