ID: 911503524

View in Genome Browser
Species Human (GRCh38)
Location 1:98719175-98719197
Sequence CACATTTAGCACTATGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911503524_911503526 -8 Left 911503524 1:98719175-98719197 CCTAGCTCATAGTGCTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 911503526 1:98719190-98719212 TAAATGTGTTAACCCATGTAGGG No data
911503524_911503531 23 Left 911503524 1:98719175-98719197 CCTAGCTCATAGTGCTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 911503531 1:98719221-98719243 ATATTGCCTGGCCCATAGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 291
911503524_911503529 11 Left 911503524 1:98719175-98719197 CCTAGCTCATAGTGCTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 911503529 1:98719209-98719231 AGGGTGCTTAGAATATTGCCTGG 0: 1
1: 0
2: 14
3: 98
4: 629
911503524_911503532 24 Left 911503524 1:98719175-98719197 CCTAGCTCATAGTGCTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 911503532 1:98719222-98719244 TATTGCCTGGCCCATAGGAAGGG 0: 1
1: 0
2: 2
3: 26
4: 183
911503524_911503525 -9 Left 911503524 1:98719175-98719197 CCTAGCTCATAGTGCTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 911503525 1:98719189-98719211 CTAAATGTGTTAACCCATGTAGG 0: 1
1: 0
2: 1
3: 18
4: 104
911503524_911503530 19 Left 911503524 1:98719175-98719197 CCTAGCTCATAGTGCTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 911503530 1:98719217-98719239 TAGAATATTGCCTGGCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911503524 Original CRISPR CACATTTAGCACTATGAGCT AGG (reversed) Intronic
900771317 1:4547068-4547090 AACAATTAGCAGTATTAGCTGGG + Intergenic
902616107 1:17624391-17624413 CACATCTAGCACCATGGACTTGG - Exonic
907116644 1:51974779-51974801 CACAATTAACACTATGAAGTAGG - Intronic
911153563 1:94618402-94618424 CACTTTTAGCTATATGAACTTGG - Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912618735 1:111133670-111133692 CACATCCAGCTCTATGACCTTGG - Intronic
915235030 1:154474197-154474219 CACGTTTATCAGTGTGAGCTGGG + Intronic
918775181 1:188619811-188619833 CACATATATCATTATAAGCTTGG - Intergenic
924485760 1:244481959-244481981 CACATTAAGACCTAAGAGCTAGG + Intronic
1065284074 10:24170409-24170431 CAAATTTCACACAATGAGCTTGG - Intronic
1067053435 10:43038192-43038214 CACAATAAGCACAGTGAGCTTGG - Intergenic
1069537571 10:69266088-69266110 CACATTTAGCCCTATGTGGTAGG - Intronic
1070323265 10:75370997-75371019 CACTTTTCTCACTTTGAGCTAGG - Intergenic
1072324620 10:94285745-94285767 CACATTCTCCACTCTGAGCTGGG + Intronic
1073068445 10:100778424-100778446 CATATCCAGCACTGTGAGCTAGG + Intronic
1074265562 10:111899637-111899659 CACATTTAGCAGTGTGACTTTGG + Intergenic
1074461542 10:113642643-113642665 AGCATTCATCACTATGAGCTGGG + Intronic
1079084291 11:17434081-17434103 CACATTTAGAACTATGTAGTTGG - Intronic
1079170319 11:18087949-18087971 CTAATGTAGCACTATGGGCTAGG + Intronic
1079820906 11:25126997-25127019 CACAATTAGAACTAAGAGCATGG + Intergenic
1081236592 11:40654266-40654288 GACATTTTGCACTGTGTGCTGGG + Intronic
1081912211 11:46707018-46707040 CACTTGTAGCACTGTGAACTTGG - Intergenic
1082556423 11:54567986-54568008 CATACTAAGCACTATGTGCTAGG - Intergenic
1083204082 11:61137532-61137554 CATATTAAGCACTGTGAGCATGG - Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1087832291 11:102832247-102832269 CACATTAACCATTAGGAGCTGGG - Intergenic
1088453473 11:110008132-110008154 CTCATGCAGCACTATGTGCTAGG + Intergenic
1089380962 11:118031295-118031317 CACATCTACCACTAAGATCTTGG + Intergenic
1091258796 11:134217209-134217231 AACATTTAGCAGTAGGAGCCAGG - Intronic
1095166032 12:38973104-38973126 CACACTTAGCACTCAGATCTTGG - Intergenic
1096874311 12:54615355-54615377 CACATACAGCCCCATGAGCTGGG + Intergenic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1099261840 12:80392047-80392069 CACATATAGAACTATTAGGTTGG - Intergenic
1102659008 12:114508750-114508772 GACATTTTTCACCATGAGCTGGG + Intergenic
1111398077 13:87694159-87694181 CATAATTATTACTATGAGCTTGG + Exonic
1112449948 13:99499226-99499248 CACATTTACCACTATCAGGAAGG - Intergenic
1115517710 14:34202576-34202598 GAGATTTGGCAGTATGAGCTTGG + Intronic
1116098325 14:40401929-40401951 GACAGCTAGCACTAAGAGCTAGG - Intergenic
1116991366 14:51280380-51280402 CACATCTAGCTCTATGATCTTGG - Intergenic
1118187821 14:63553608-63553630 TTCATTGAACACTATGAGCTAGG + Intergenic
1121525872 14:94618966-94618988 CTCATTTAGCACAAGGAACTAGG + Intronic
1136993596 16:35172717-35172739 CACACTCAGCACTGTGAACTGGG - Intergenic
1138415997 16:56871658-56871680 CTCATTTAGCAGGATGACCTGGG - Intronic
1140841868 16:78847178-78847200 CATATTTAGAACTAAGATCTAGG + Intronic
1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG + Intronic
1141263280 16:82473120-82473142 AGCATTTACTACTATGAGCTGGG - Intergenic
1148002288 17:44396937-44396959 CACATTTGGCACTGTTATCTTGG - Intronic
1150331150 17:64295344-64295366 CACAATTAGCTGTATGACCTTGG + Intergenic
1150478794 17:65493657-65493679 CACTTCTAGCTCTATGAACTTGG + Intergenic
1150767896 17:68016741-68016763 AACATTCAGCACTAAGTGCTCGG + Intergenic
1153160439 18:2198741-2198763 TACATTTAGCACTACAAGTTGGG - Intergenic
1153581199 18:6575492-6575514 CACATTTACTACTAATAGCTGGG - Intronic
1154387638 18:13909874-13909896 TACATTGAGCACTCTGATCTTGG - Intronic
1157220091 18:45823234-45823256 CAAATTTAGGAATTTGAGCTTGG + Intergenic
1157245672 18:46052177-46052199 CAAATATAGAACTAGGAGCTAGG + Intronic
1158190819 18:54826699-54826721 CACAGTGACCACTGTGAGCTCGG + Intronic
926848553 2:17169334-17169356 CACACAGAGCACTTTGAGCTTGG + Intergenic
928051475 2:28001032-28001054 CACATCTGGCACTAAGATCTTGG - Intronic
930790362 2:55320685-55320707 CACATTTAAAATTATGAGTTAGG - Intronic
938077496 2:128347398-128347420 CACTTTTAGGACCATCAGCTAGG + Intergenic
948659494 2:239498371-239498393 CACATGTGGAACTATGATCTGGG - Intergenic
1170045655 20:12082739-12082761 CACATTTATTCCTATGACCTGGG + Intergenic
1178603079 21:34011959-34011981 CACATTTAGCACCTAGATCTTGG - Intergenic
1179319735 21:40278808-40278830 AACATTTATCACTATATGCTAGG - Intronic
1181661720 22:24355309-24355331 CACATTTAGCACCTGGATCTTGG - Intronic
949100809 3:142798-142820 CACATTTAGCACACAGATCTTGG - Intergenic
950804788 3:15590672-15590694 CACATTTTACACACTGAGCTTGG + Intronic
953823298 3:46228409-46228431 CAAATTCAGCACTAAGAGATAGG - Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955204917 3:56887255-56887277 CACAATTAGCAACATGTGCTGGG + Intronic
956258211 3:67307372-67307394 CACATCTATCAGTATGAACTGGG + Intergenic
958089869 3:88862983-88863005 CATATTAAGCACTATGATCAAGG + Intergenic
960534010 3:118796493-118796515 AAGATTTAGAACTATGATCTAGG - Intergenic
960905199 3:122593995-122594017 AACATATAGCAATATGAGATAGG + Intronic
963227204 3:142874372-142874394 CACATTTAAAACCATCAGCTCGG - Intronic
965984127 3:174731128-174731150 AACATTTATGACTTTGAGCTGGG + Intronic
970492441 4:16588229-16588251 CAGATTTAGCACTGTGATCAGGG + Intronic
973248392 4:48035348-48035370 CACCAATACCACTATGAGCTAGG - Intronic
976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG + Intronic
978403560 4:108356189-108356211 CCCATCTGGCACTGTGAGCTGGG + Intergenic
987048093 5:14126152-14126174 CTCATTGAGCCCTATGTGCTAGG - Intergenic
989332477 5:40275957-40275979 CACATTTAGCCCTCTTAGCCAGG + Intergenic
989360952 5:40600503-40600525 CCCATTTAGCACTATCAGAAAGG - Intergenic
992576067 5:78114093-78114115 TTCCTTTAGCACTGTGAGCTTGG + Intronic
995074314 5:107963745-107963767 CACATTTAGCTCTGGGAGCATGG + Intronic
995322769 5:110855917-110855939 CACATTTGGTCATATGAGCTTGG - Intergenic
997803542 5:136890645-136890667 CACTTTTATGACTATGAGCCAGG + Intergenic
998782945 5:145678518-145678540 CATATTTAGCATTATGATTTAGG - Intronic
1000796752 5:165673611-165673633 CACTTTTATAACTATAAGCTTGG + Intergenic
1009803767 6:68575637-68575659 CACAGTTAACAATATGACCTAGG + Intergenic
1012846652 6:104397733-104397755 TGCAATTAGCACTGTGAGCTTGG - Intergenic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG + Intergenic
1018264874 6:162013586-162013608 CACAGTTATCACTATGCACTTGG - Intronic
1022817684 7:33929112-33929134 CAGAGTTTGCACTGTGAGCTGGG + Intronic
1025639108 7:63350600-63350622 CAGACTTAGCACTGTGAACTGGG + Intergenic
1025643591 7:63397492-63397514 CAGACTTAGCACTGTGAACTGGG - Intergenic
1025713178 7:63930524-63930546 CAGACTTAGCACTGTGAACTGGG - Intergenic
1027795290 7:82685407-82685429 TTCATTAAGCACTATGACCTGGG + Intergenic
1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG + Intronic
1030956610 7:115860707-115860729 CACATCTAACACTATGTGCCAGG + Intergenic
1035915920 8:3622083-3622105 CACAGTCTGCACTATGTGCTGGG + Intronic
1039142328 8:34403742-34403764 CACAGTTTGCTCTGTGAGCTGGG + Intergenic
1042804136 8:72753877-72753899 CACATTAAGCAATATGTTCTTGG + Intronic
1043259713 8:78181095-78181117 GACATTTAACAATATGAACTGGG - Intergenic
1043969907 8:86517233-86517255 CACATTTACCAATATGAATTAGG + Intronic
1047302026 8:123621729-123621751 CACAGTTAGCAGTAGGACCTGGG + Intergenic
1047846443 8:128810909-128810931 CACACTTAGCACTCAGATCTTGG + Intergenic
1049055913 8:140237508-140237530 CAAATTTAGGACTAGGAGCCAGG + Intronic
1053874514 9:42529663-42529685 GACATTTTGCACCATGTGCTTGG - Intergenic
1055223561 9:73967182-73967204 CCCATTTGGCACTATTATCTAGG + Intergenic
1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG + Intronic
1061581252 9:131538143-131538165 CACATTTTGCACTCTTTGCTTGG - Intergenic
1189314436 X:40044247-40044269 CACATCTAGCACTAAGTTCTTGG - Intergenic
1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG + Intergenic
1191621413 X:63219392-63219414 CACATCTAGCACAAAGATCTTGG - Intergenic
1193317724 X:80083183-80083205 TAGATTTAGCATTATGGGCTGGG - Intergenic
1196799977 X:119533682-119533704 CAGATATTGCACTAGGAGCTGGG - Intergenic