ID: 911503525

View in Genome Browser
Species Human (GRCh38)
Location 1:98719189-98719211
Sequence CTAAATGTGTTAACCCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911503524_911503525 -9 Left 911503524 1:98719175-98719197 CCTAGCTCATAGTGCTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 911503525 1:98719189-98719211 CTAAATGTGTTAACCCATGTAGG 0: 1
1: 0
2: 1
3: 18
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911503525 Original CRISPR CTAAATGTGTTAACCCATGT AGG Intronic
901104934 1:6747797-6747819 CTAAATGTATTATGCCATGTGGG + Intergenic
901386814 1:8915251-8915273 ATAAATCTGTTAACCCTTTTTGG - Intergenic
905102190 1:35533937-35533959 CTGAATGTGCTAACCCCTGCAGG - Intronic
907660341 1:56386314-56386336 ATAAATGTGTTCAACCCTGTGGG + Intergenic
908114563 1:60928123-60928145 CAACATGTTTAAACCCATGTTGG + Intronic
908347992 1:63255288-63255310 CTAAATGTTTTAAGTCATTTTGG + Intergenic
909136152 1:71802944-71802966 CCAAAAGTCTTAACCCATTTTGG - Intronic
910404217 1:86869307-86869329 CTAAATGTGTAAAACGATATTGG + Intronic
911503525 1:98719189-98719211 CTAAATGTGTTAACCCATGTAGG + Intronic
912729865 1:112092724-112092746 CCAAATGTGGAGACCCATGTGGG + Intergenic
915157227 1:153887698-153887720 CTTAATGTGTTAACTCATTATGG + Intronic
916592305 1:166204378-166204400 CTAACTGTGACAACCCAGGTAGG - Intergenic
922687618 1:227657055-227657077 TGAAATGTGTTCCCCCATGTTGG + Exonic
1065079837 10:22117616-22117638 CTAAATGTTTTAATCAATATTGG + Intergenic
1076233282 10:128839594-128839616 CTCAATGTGTTAATACATGCAGG - Intergenic
1077874613 11:6293639-6293661 CTTGCTGTGTTAACCCGTGTTGG - Intergenic
1084302117 11:68258713-68258735 CTAAATCTGTTAGCCCACGTGGG + Intergenic
1087193388 11:95280257-95280279 TTAAATGTGTTAACTCAAGTGGG - Intergenic
1088215535 11:107504316-107504338 CTAAATGTAGTAAATCATGTAGG - Exonic
1089909927 11:122087661-122087683 CTAGATGTGTAAAGTCATGTAGG - Intergenic
1095673607 12:44890677-44890699 ATAAATGTGTGAACCCTTGGGGG - Intronic
1096539202 12:52295253-52295275 TTAAATGAGTTAATGCATGTTGG - Intronic
1097382752 12:58915183-58915205 GTCAATGTGTTAACACATATGGG - Intronic
1098074670 12:66716205-66716227 TTAAATGTGTTCACATATGTTGG - Intronic
1100901908 12:99250842-99250864 ATAAATGTGTTAGTCCATTTGGG + Intronic
1101696034 12:107127706-107127728 TTAAATGAGTTAATCCATGCAGG + Intergenic
1102758050 12:115359638-115359660 CTAACTATGTTAACCCAGGCTGG - Intergenic
1106386668 13:29292161-29292183 CTTACTGTTTTAACCCTTGTTGG + Intronic
1107880566 13:44828836-44828858 CTTACTGTGTTATCCCATGGTGG + Intergenic
1110404316 13:75132575-75132597 CAAAATGTGTTATCCTCTGTAGG - Intergenic
1114140092 14:19900108-19900130 CTAAATGTGATTTCCAATGTTGG + Intergenic
1114823750 14:26052717-26052739 TGAAATGTGTTCCCCCATGTTGG + Intergenic
1119132654 14:72189074-72189096 GTAAATGTGTTAGACCTTGTGGG + Intronic
1127655960 15:61056232-61056254 CTAAATGAGAAAGCCCATGTAGG - Intronic
1133364426 16:5199476-5199498 CTAAATGAGCTAACTCATGTAGG - Intergenic
1137069492 16:35889003-35889025 GTAAATGTGTTAATGCATGTAGG + Intergenic
1139491183 16:67286878-67286900 GCAAATGTGTCAACCCCTGTGGG - Exonic
1143002318 17:3802263-3802285 GTGAATGTGTTAACCCAGGGTGG + Intergenic
1147790505 17:43011739-43011761 CTAATTGGGTTAACCCCTTTGGG + Intronic
1151912359 17:77092245-77092267 CTCAATGTGCTTACCCCTGTAGG - Intronic
1155344147 18:24842032-24842054 CTAAATGAGATGATCCATGTAGG + Intergenic
1156677814 18:39552037-39552059 CAAAATGTGCTAAGCCATGGAGG + Intergenic
1158327258 18:56325383-56325405 CTGGATGTGGTTACCCATGTGGG - Intergenic
1158727272 18:59985055-59985077 CTGAATGAGATAATCCATGTAGG + Intergenic
1159992501 18:74926180-74926202 CCAAATGTGTTGAGCCATGATGG - Intronic
1160430127 18:78805213-78805235 GTAAATGTGTTGGCCCATGAAGG - Intergenic
925670651 2:6306650-6306672 ATAAATGAGTTCACCCATGGTGG + Intergenic
929318814 2:40514939-40514961 CAAAATGTATTTGCCCATGTTGG + Intronic
930557608 2:52918957-52918979 CTATATTAGTTAACCCATGTGGG - Intergenic
931316522 2:61138098-61138120 CACAATGTGTATACCCATGTAGG - Intergenic
933368725 2:81388477-81388499 CTAATTGTGTTAATTCCTGTTGG - Intergenic
935527463 2:104188349-104188371 CTAAATCTGTTACTCCATCTTGG + Intergenic
935837111 2:107066793-107066815 CCAAATGTGTTAACCGAGGAAGG + Intergenic
937556480 2:123164216-123164238 CCAAACATGTTTACCCATGTAGG + Intergenic
937580527 2:123481715-123481737 CTAAATATTTTAAGCTATGTGGG - Intergenic
940084389 2:149841986-149842008 CTAAATGTATCAATGCATGTAGG + Intergenic
947866487 2:233401231-233401253 CTAAATGAGTTAATGAATGTAGG + Intronic
948149213 2:235731725-235731747 ATAAATGAGCTAATCCATGTCGG - Intronic
1170530932 20:17290839-17290861 CTTCTTGTGTTAACCCATGGTGG + Intronic
1172711728 20:36929834-36929856 CTAAATGTGTTAATCCACTTGGG + Intronic
1177249713 21:18577084-18577106 GTAAATGTAATAACCAATGTTGG + Intergenic
1181064088 22:20297513-20297535 CCACATGTGGGAACCCATGTGGG - Intergenic
949629192 3:5904130-5904152 CTAAATTTGGCAACACATGTAGG - Intergenic
950648559 3:14392965-14392987 ATAAATGTGTTGTCCCCTGTGGG - Intergenic
951160567 3:19415218-19415240 TTAAATGAGTTAACCCATGTAGG - Intronic
951677944 3:25263257-25263279 CTAAATGAATTAACACATGAAGG - Intronic
951740278 3:25913804-25913826 GTAAATGTTTTAAGCTATGTGGG - Intergenic
952519516 3:34142596-34142618 TTACATGTATTAACTCATGTAGG + Intergenic
953651970 3:44814188-44814210 CTGAAGTAGTTAACCCATGTTGG + Intronic
954194231 3:48986802-48986824 CTTATTGTGTAAACCCCTGTGGG - Intergenic
955139133 3:56251753-56251775 TTAAATATGTTAACCTATATTGG + Intronic
959536695 3:107494416-107494438 CTAAATGTGTTATTTCATGTGGG + Intergenic
960025220 3:113001415-113001437 TAAAATGTGTTAGTCCATGTTGG + Intronic
964712112 3:159682183-159682205 CTAAATATGTTATCTCATTTGGG - Intronic
967196008 3:187026232-187026254 ATTAATGTTTTGACCCATGTTGG + Intronic
971313479 4:25546968-25546990 CATAATGTGTTTCCCCATGTGGG + Intergenic
975586173 4:75952286-75952308 CTAAATGTGTTAGCTAATGTTGG + Intronic
975596848 4:76055468-76055490 CTAAATGTGTTAAGTGATTTGGG - Intronic
976036620 4:80830719-80830741 CTAATTGTGTTAATCCAGGTAGG + Intronic
979719649 4:123883604-123883626 ATAAATGTCTTAACCCATTTGGG - Intergenic
981555838 4:145992576-145992598 ATAAATGTCTTAATTCATGTGGG + Intergenic
982955415 4:161759020-161759042 CTACATCTGTTAATCCATTTTGG + Intronic
990643688 5:57818475-57818497 CTAAATGTGTTAATTAATATAGG - Intergenic
991159151 5:63476102-63476124 CTAAATATATTTCCCCATGTTGG - Intergenic
991557231 5:67909384-67909406 ATAAATGTGTTAACGTATTTTGG - Intergenic
991997632 5:72403819-72403841 CTCAAGGTATTAACCCATGCAGG - Intergenic
993148594 5:84129907-84129929 CTAAAGGTGCTATCACATGTTGG + Intronic
995978737 5:118075497-118075519 TTAAATGAGATAATCCATGTAGG - Intergenic
996043308 5:118842001-118842023 CTACATTTGTTAATTCATGTGGG - Intronic
996228212 5:121028513-121028535 CATAATGTGTTCACCCATGCTGG - Intergenic
999016970 5:148117436-148117458 CTAAATATTTTAAGCAATGTGGG + Intronic
999638163 5:153643961-153643983 CTAAATGTGTGAAACCAAGTAGG + Intronic
1006044728 6:31284978-31285000 CTAAATCTGTTAATTCATGATGG + Intronic
1012852932 6:104468666-104468688 TTGAATGTGTTAAACCATGAAGG + Intergenic
1017291123 6:152738723-152738745 CTAAATGTGCTAATCCATTTGGG - Intergenic
1021453951 7:20809203-20809225 CCAAATGTGTTATGCCATTTGGG + Intergenic
1023074736 7:36471614-36471636 CTAAATGTTTTAACTTATTTAGG + Intergenic
1025724775 7:64046389-64046411 TTAAATGTAATACCCCATGTTGG + Intronic
1030859827 7:114611853-114611875 CTACATGTCTTTACCCATGAAGG - Intronic
1034317422 7:150145564-150145586 CTAAATGTGTGACCCTATGTAGG - Intergenic
1034775329 7:153821663-153821685 CTAAATGTGTGACCCTATGTAGG + Intergenic
1037065511 8:14572460-14572482 TTAAATGAGTTAACACCTGTGGG - Intronic
1037929388 8:22868799-22868821 CTAAGTGTGATAATCCAGGTAGG - Intronic
1038558396 8:28545644-28545666 CTACATGTGAGAACCCAAGTGGG + Intronic
1039219509 8:35313560-35313582 CTAAATGGGATAATGCATGTGGG + Intronic
1042132191 8:65598417-65598439 CTCACTGTGTTATCCCATGTTGG - Intergenic
1045661943 8:104447232-104447254 TTAAATGAGTTTACCTATGTAGG + Intronic
1048790546 8:138099496-138099518 CTAAATGTCTTAATCCACCTTGG - Intergenic
1050681343 9:8115310-8115332 CTAAAGGTGTTAGCCTATGTGGG + Intergenic
1050849584 9:10266784-10266806 CTAAATTTTTTAACCTAGGTGGG - Intronic
1052244764 9:26321169-26321191 CTAAAAGGGGTAACCCACGTAGG - Intergenic
1053918306 9:42962380-42962402 CGAAATGTGATCCCCCATGTTGG + Intergenic
1054961905 9:70978645-70978667 CGAAATGTCTTACCCCATGACGG - Intronic
1055329519 9:75169388-75169410 CTTAAAGTGTTTACCCCTGTGGG + Intergenic
1055884701 9:81047436-81047458 CTTGATGTGTTACCCAATGTGGG + Intergenic
1057720734 9:97529893-97529915 CTAAATGAGATAATCCACGTAGG - Intronic
1058340006 9:103883556-103883578 CTAAATATGTTTACCATTGTAGG - Intergenic
1186082894 X:5952629-5952651 CTAAATTTGTTCACCAATATAGG + Intronic
1191734194 X:64371988-64372010 ATAAATATGTTAAACAATGTAGG + Intronic
1193560269 X:83009478-83009500 CTAATTGTGTTAACTCCTGTCGG + Intergenic
1193919132 X:87404671-87404693 CCAAAGCTGTTAACACATGTGGG + Intergenic
1195133986 X:101885197-101885219 CTAAAAATGTTAAGGCATGTTGG + Intronic
1199922644 X:152425405-152425427 GTAAATGTGTGATCCAATGTAGG + Intronic
1201512399 Y:14779651-14779673 CTAAATTTGTTCACCAATATAGG - Intronic