ID: 911503526

View in Genome Browser
Species Human (GRCh38)
Location 1:98719190-98719212
Sequence TAAATGTGTTAACCCATGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911503524_911503526 -8 Left 911503524 1:98719175-98719197 CCTAGCTCATAGTGCTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 911503526 1:98719190-98719212 TAAATGTGTTAACCCATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911503526 Original CRISPR TAAATGTGTTAACCCATGTA GGG Intronic
No off target data available for this crispr