ID: 911503529

View in Genome Browser
Species Human (GRCh38)
Location 1:98719209-98719231
Sequence AGGGTGCTTAGAATATTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 0, 2: 14, 3: 98, 4: 629}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911503524_911503529 11 Left 911503524 1:98719175-98719197 CCTAGCTCATAGTGCTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 911503529 1:98719209-98719231 AGGGTGCTTAGAATATTGCCTGG 0: 1
1: 0
2: 14
3: 98
4: 629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911503529 Original CRISPR AGGGTGCTTAGAATATTGCC TGG Intronic
900657681 1:3767818-3767840 AAGGTACTTAGAATGGTGCCTGG - Intronic
900816390 1:4849857-4849879 AAAGTGCTCAGAATCTTGCCCGG + Intergenic
900934196 1:5755149-5755171 AAGGTGCTCAGAATAGTGCTGGG + Intergenic
901517514 1:9758737-9758759 AAAGTGCTTAAAACATTGCCTGG + Intronic
901546618 1:9962526-9962548 AAGGGGCTTAGCATATTGCCTGG - Intronic
901584708 1:10279466-10279488 AAGGTGCCTAGAATAGGGCCTGG - Intronic
902734134 1:18388931-18388953 AAGGTGCTTAGCACAGTGCCTGG - Intergenic
902793115 1:18782646-18782668 AATGTGCTTATAATGTTGCCTGG + Intergenic
902906580 1:19562815-19562837 AAGGTGCTTAGAATAGGGTCTGG + Intergenic
903037709 1:20504812-20504834 AAAGTGCCTAGCATATTGCCTGG - Intronic
903134531 1:21300899-21300921 AAGGTGCTTTGTATAGTGCCTGG + Intronic
903314222 1:22488541-22488563 AGCATGCTTAGTATATTCCCAGG + Intronic
903889505 1:26560219-26560241 AAAGTGCTTAGAATAGTGCCTGG + Intronic
904451628 1:30616646-30616668 CTAGAGCTTAGAATATTGCCTGG - Intergenic
905008876 1:34733348-34733370 AAAGTGCTTAGAAAGTTGCCTGG + Intronic
905174874 1:36128905-36128927 AAAGTGCTCAGAATAGTGCCTGG - Intergenic
905245637 1:36611376-36611398 AGAGTGCTTAGCACAGTGCCTGG + Intergenic
905520581 1:38596479-38596501 AGGGTACTTAGCATAGTACCCGG - Intergenic
905948499 1:41924685-41924707 AGAGTGCTTAGAACAATGCCTGG + Intronic
906071176 1:43017636-43017658 GGGGTACTTAGAATTGTGCCTGG - Intergenic
906541544 1:46590403-46590425 AAAGTGCTTAGAATGCTGCCTGG - Intronic
906654714 1:47539421-47539443 AAGGTACTTAGAATAGTGCCTGG + Intergenic
906937641 1:50227972-50227994 AGCGTGCCTAGGATATTGCAGGG - Intergenic
907218727 1:52889032-52889054 AAAGTGCTTACAACATTGCCTGG - Intronic
907254217 1:53166109-53166131 AAAGTGCTTAGAATAATGCCTGG - Intergenic
907562072 1:55400088-55400110 AAGGTTCTTAGCATAGTGCCTGG + Intergenic
908000260 1:59672340-59672362 TTGGTGCTTAGCATATTTCCTGG - Intronic
908141198 1:61187142-61187164 AAAGTGCTTAGCATATTGCTTGG + Intronic
908429688 1:64043896-64043918 AAGATGCTCAGAATAGTGCCTGG + Intronic
908605029 1:65789404-65789426 AAAGTGGTAAGAATATTGCCTGG + Intergenic
908848714 1:68351466-68351488 AGAGTGTTTAGAAGAGTGCCTGG + Intergenic
908855593 1:68423381-68423403 ACGGTGCTTGGAATAGAGCCTGG + Intergenic
909123737 1:71638569-71638591 AATGTGCTTAGAATAGTTCCTGG - Intronic
909388277 1:75086177-75086199 AAAGTGCTTAGAATAGTGCCTGG - Intergenic
909926679 1:81445873-81445895 AAAATGCTTAAAATATTGCCTGG + Intronic
910327051 1:86021587-86021609 ATAGTCCTTAGAATACTGCCTGG + Intronic
910612558 1:89160610-89160632 TGAGTGCTTAGAATAGTTCCTGG + Intronic
910735964 1:90458074-90458096 ATAGTGCTTAGAATAGTGCATGG - Intergenic
911053286 1:93690365-93690387 AGGGTTCTTAGAACAGTACCAGG - Intronic
911056482 1:93712657-93712679 AAGGTGCTTAGCATGCTGCCTGG - Intronic
911187765 1:94920525-94920547 AAAGTGTTTAGAATAATGCCTGG - Intronic
911225470 1:95300526-95300548 AAAGTACTTAGAATAGTGCCTGG + Intergenic
911421601 1:97648691-97648713 AAAATGCTTAGAATAATGCCTGG - Intronic
911503529 1:98719209-98719231 AGGGTGCTTAGAATATTGCCTGG + Intronic
911660643 1:100497900-100497922 AAGGTTCTTAGAACAGTGCCTGG + Intronic
911779278 1:101855214-101855236 AAAGTTCTTAGAATAGTGCCTGG - Intronic
912503720 1:110141092-110141114 AAGTTGCTTAGAGTAGTGCCTGG + Intergenic
912706300 1:111917398-111917420 GGAGTGCTTAGAATAGTCCCTGG + Intronic
912717644 1:111993232-111993254 AAAGTGCTTAGAATCGTGCCTGG + Intergenic
912748009 1:112261898-112261920 AAAGTGCTTAGAATATAGTCTGG - Intergenic
913183518 1:116345439-116345461 AAAATGCTTAGAATAGTGCCTGG - Intergenic
913199773 1:116486244-116486266 TAAGTGCTTAGAACATTGCCAGG + Intergenic
913336302 1:117711581-117711603 AAAGTGCTTAGATTAGTGCCTGG - Intergenic
913404331 1:118472514-118472536 AAAGTGCTTAGAATATTCCAGGG - Intergenic
914320517 1:146555175-146555197 CAAGTGCTTAGAATAATGCCTGG - Intergenic
914354913 1:146876358-146876380 ACAGTGCTTAGAACACTGCCTGG + Intergenic
914396495 1:147274268-147274290 AGAGTGCTTAGAATAATGCCTGG + Intronic
915579967 1:156807706-156807728 AGGATGATTAGAAAGTTGCCAGG + Intronic
915702353 1:157807932-157807954 AAGGAGCTTAGACTAGTGCCTGG + Intronic
916900919 1:169222317-169222339 TTGGTGCCTAGAATACTGCCTGG + Intronic
917241483 1:172953626-172953648 AAAGTGCTTAGAATAGTGCTGGG + Intergenic
917453033 1:175162945-175162967 AGAGTGCCTAGAAAAGTGCCTGG - Intronic
917488251 1:175474957-175474979 TTAGTGCTTAGAATAATGCCAGG + Intronic
917829354 1:178862979-178863001 AGAGTGCTTAGAACAGTGCCTGG - Intronic
918015294 1:180627807-180627829 AAAGTGCTTAGAACAGTGCCTGG + Intergenic
918105863 1:181414637-181414659 AAGGTGCTTGGAATGTTGCCTGG - Intronic
918427164 1:184422378-184422400 AAGGTGCTAAGAATGCTGCCTGG - Intronic
918456444 1:184723200-184723222 AAAGTGCTTAGAACAGTGCCGGG - Intronic
918889758 1:190251300-190251322 AAGGTGCTTAGAACAGTACCTGG - Intronic
919844633 1:201634009-201634031 AAGGTGCTTATAACAATGCCTGG - Intronic
919849312 1:201661897-201661919 AAAGTGCTTAGAACAGTGCCTGG - Intronic
920007427 1:202843676-202843698 ACAGTGCTTAGAATAGTACCTGG - Intergenic
920607155 1:207399748-207399770 AGGATGCTTAGAACAGTTCCTGG + Intergenic
920710049 1:208286587-208286609 AAGTTACTTAGAATAGTGCCTGG - Intergenic
922557881 1:226546940-226546962 AGGGTTTTTAGAATGATGCCTGG + Intergenic
922932260 1:229399367-229399389 AGGGTGCTCAGAATGGTGCCAGG - Intergenic
923030244 1:230243758-230243780 AGAGTGCTTAGAACATTGCCCGG + Intronic
923365562 1:233257515-233257537 AAAGTGCTTAGAACACTGCCTGG + Intronic
923469227 1:234275841-234275863 ACAGTGCTTAGAATAGTACCTGG - Intronic
923642338 1:235777634-235777656 TAAGTGCTTAGAATAGTGCCTGG - Intronic
923978109 1:239287699-239287721 CCGGTGTTTAGACTATTGCCTGG + Intergenic
924187381 1:241508214-241508236 AGAGTGCTTAGAAGCATGCCTGG - Intronic
924392172 1:243573996-243574018 ACAGTGCTGAGTATATTGCCAGG + Intronic
1063922555 10:10946660-10946682 GAGGGGCTTAGAATAGTGCCTGG - Intergenic
1064314054 10:14238167-14238189 AAGGTGCTTAGTACAGTGCCTGG - Intronic
1066400747 10:35073491-35073513 AGGGTACTTAGACTAGTGCTTGG - Intronic
1067269574 10:44778454-44778476 AAAGTGCTTAGAATAGTGCCTGG - Intergenic
1067660999 10:48236194-48236216 TGGGGGCCTAGAATAGTGCCTGG + Intronic
1067709791 10:48638701-48638723 ACGGTGCCTAGAATTATGCCTGG - Intronic
1067813015 10:49445543-49445565 AAAGAGCTTAGAATAGTGCCTGG - Intergenic
1068290125 10:54990731-54990753 AGAGAGATTTGAATATTGCCAGG - Intronic
1068478274 10:57556141-57556163 AGGGGACTTAGAATATTCTCTGG + Intergenic
1068629156 10:59282239-59282261 AAAGTGCTTAGAACAGTGCCAGG + Intronic
1068773729 10:60849889-60849911 AAGGTGCTTAGAACATTGCCTGG - Intergenic
1068990150 10:63141580-63141602 ACAGTGCTTAGAATGGTGCCTGG - Intronic
1069379754 10:67830679-67830701 AAAGTGCTTAGAAAAGTGCCTGG - Intronic
1069798172 10:71066447-71066469 AGAGTGCTTAGAACAGTGCCTGG + Intergenic
1069798469 10:71068116-71068138 AGAGTGCTTAGAACAGTGCCTGG - Intergenic
1070282112 10:75057585-75057607 AGGATGCTTAGCACAATGCCTGG + Intronic
1070694002 10:78548413-78548435 AGAGTGCTCAGTACATTGCCTGG + Intergenic
1070832727 10:79430125-79430147 AAGGTGCTTAGCACAGTGCCTGG - Intronic
1071511226 10:86263699-86263721 AAAGTGCTTAGAACAGTGCCTGG + Intronic
1071823462 10:89301042-89301064 AATGTCCTTAGAATAATGCCTGG - Intronic
1072079051 10:92010024-92010046 AAGCTGCTTAGAATAGTGCCTGG - Intronic
1072155729 10:92722044-92722066 ATAGTGCTTAGAATAGTGCCTGG + Intergenic
1072447523 10:95512464-95512486 ATGGTACTTAGAATTGTGCCTGG - Intronic
1072941264 10:99766279-99766301 ACGGTGCCTGGAATAGTGCCTGG - Intergenic
1073239424 10:102046149-102046171 AAAGTGCTTAGAACAGTGCCTGG - Intronic
1074049907 10:109872205-109872227 ACAGTGCTTAGAATAGTGCGTGG - Intronic
1074082911 10:110181898-110181920 AGGGAGCTGAGAATCTTACCAGG - Intergenic
1074727157 10:116323405-116323427 AGGGTGTTCAAAATAGTGCCTGG + Intergenic
1074736687 10:116441860-116441882 AAAGTGCTTAGAACAATGCCTGG + Intronic
1074762713 10:116679251-116679273 TGGGTGCTTAGAACAATGCCTGG - Intronic
1074890896 10:117735819-117735841 AGAGTGCTTAGAATGCGGCCTGG + Intergenic
1075401044 10:122161938-122161960 AGGGTGCTGAGAATGGTGACAGG + Intronic
1075620873 10:123927434-123927456 GAGGTGCTTAGGATAGTGCCTGG - Intronic
1076923496 10:133467713-133467735 AGGATGCCTTGAACATTGCCAGG + Intergenic
1078008642 11:7552271-7552293 AAGGTGCTTAGAACAGTGCCTGG + Intronic
1078105509 11:8355798-8355820 AAGGTGCTTAGACCAGTGCCTGG + Intergenic
1078667001 11:13334031-13334053 ACGGAGCTTAGAACAGTGCCTGG - Intronic
1078852020 11:15172627-15172649 AGGGTGAGTAGAAACTTGCCAGG + Intronic
1078907006 11:15697028-15697050 AAAGTGCTTAGAATAGTGTCTGG - Intergenic
1078939183 11:15981873-15981895 AAAGTGCTTAGAACATTGCCTGG - Intronic
1079228209 11:18626724-18626746 AAAGTGCTTAGAACAGTGCCTGG + Intronic
1079316279 11:19410362-19410384 AAAGTGCTTAGAATAGTGCAGGG - Intronic
1079569085 11:21920761-21920783 AAAGTGCTTAGCACATTGCCAGG - Intergenic
1079710537 11:23678416-23678438 AAAGTGCTTAGCACATTGCCTGG + Intergenic
1080056465 11:27911661-27911683 AAAGCGCTTAGAATAGTGCCTGG + Intergenic
1080885572 11:36364544-36364566 AAAGTTCTTAGAATAGTGCCTGG + Intronic
1081463120 11:43289758-43289780 AAAGTGCTTAGACAATTGCCTGG - Intergenic
1081487320 11:43541484-43541506 AAAGTGCTTAGAATAGTGTCTGG - Intergenic
1081535058 11:43990221-43990243 AGAGTGCTTAGGACGTTGCCTGG + Intergenic
1082072193 11:47948135-47948157 TACGTGCTTAGAATACTGCCTGG - Intergenic
1082641647 11:55668379-55668401 AAAGTGCTTAGAAAAGTGCCTGG - Intergenic
1082740106 11:56901326-56901348 AAAGTGCTTAGAACAATGCCTGG + Intergenic
1082785021 11:57311928-57311950 AAAGTGCTAAGAATAGTGCCTGG - Intronic
1083061285 11:59875247-59875269 AGGGTGCTTAGAGTAGTACCTGG + Intergenic
1083284409 11:61648934-61648956 ACTGTGCTTAGACTATGGCCTGG - Intergenic
1083349916 11:62020334-62020356 TAAGTGCTTAGAATAGTGCCTGG + Intergenic
1083541253 11:63512840-63512862 GTGGTACTTAGAATAGTGCCTGG + Intronic
1083740408 11:64707592-64707614 AAAGTGCTTAGAACAGTGCCTGG - Intronic
1084586410 11:70065320-70065342 AGGAGGCTTTGCATATTGCCGGG + Intergenic
1085437768 11:76524269-76524291 AAAGTGCTTAGAATAGTGCCTGG + Intronic
1085652951 11:78284839-78284861 TTGGTGTTTAGAATATTGCCTGG + Intronic
1085792144 11:79505368-79505390 AGGGTGCTTATCACAATGCCAGG - Intergenic
1086186067 11:84017815-84017837 AAAGTGCTTAGAACAGTGCCTGG - Intronic
1086336330 11:85804593-85804615 ATAGTGCTTGGAATACTGCCTGG + Intronic
1086358036 11:86025880-86025902 AAAGTGCTTAGAACAGTGCCTGG - Intronic
1086829998 11:91550495-91550517 AAGGTGCTTAGTACATCGCCTGG + Intergenic
1087270524 11:96107169-96107191 ATGGTGTTTATAATCTTGCCGGG - Intronic
1088051566 11:105521669-105521691 AGGGTGCTTAGAATAGTGTGTGG - Intergenic
1088222446 11:107583553-107583575 AAAGTGCTTAGGATAGTGCCTGG + Intergenic
1088621965 11:111694043-111694065 AGGGTACTTAGAACAGTGCCCGG + Intronic
1088693854 11:112349722-112349744 AAAGTGCTTAGAATAGTGCCTGG + Intergenic
1088753234 11:112863674-112863696 AAAGTGCTTAGAACAGTGCCTGG - Intergenic
1089548753 11:119253270-119253292 AAAGTACTTAGAATAATGCCTGG + Intronic
1089801618 11:121035189-121035211 AGGGTGGTTAGCACAGTGCCTGG - Intronic
1089810643 11:121128610-121128632 AAGGGGCTTAGAATAGTGCTTGG - Intronic
1090085638 11:123648469-123648491 TTCGTGCTTAGAATAATGCCTGG - Intronic
1090309595 11:125723336-125723358 AGAGTGCTTAGAAGAGTGTCTGG + Intergenic
1090328817 11:125913195-125913217 AGGGAGCTTGGAATATTGGCAGG - Intronic
1091143732 11:133258855-133258877 AGGCTTCTTAGAATGTTTCCTGG + Intronic
1091256418 11:134190737-134190759 AGAGTGCTGGGAATATAGCCTGG + Intronic
1091301651 11:134511617-134511639 AGAGGGCTTTGAATAGTGCCAGG + Intergenic
1091953262 12:4613349-4613371 ACAGTGCTTAGAATAATGCCCGG + Intronic
1092048782 12:5453118-5453140 AGAATGCTTAGAACAATGCCTGG + Intronic
1092132696 12:6123734-6123756 TGGGTGCTAAGCATCTTGCCAGG - Intronic
1092585049 12:9891185-9891207 AAGGTGCTTAGAAACCTGCCTGG + Intronic
1093709939 12:22319176-22319198 AGAGTGCTGAAAATAGTGCCTGG + Intronic
1093908916 12:24724020-24724042 AAGGTGCTCAGCATAATGCCAGG + Intergenic
1094002619 12:25711939-25711961 AAAGTGCTTAGAACAGTGCCTGG - Intergenic
1094142608 12:27196326-27196348 AAGGTACTTAAAATATTGGCAGG + Intergenic
1094175112 12:27533364-27533386 AAGGTGCTTAGAGTAGTGCTTGG - Intronic
1094185429 12:27637233-27637255 CTGGTGCTTAGAAGAATGCCTGG + Intronic
1094195731 12:27748040-27748062 AAGGCACTTAGAATAGTGCCTGG + Intronic
1094368984 12:29715555-29715577 AAAGTGCTTAGAATAGTTCCTGG - Intronic
1095336039 12:41027701-41027723 AAAGTGCTTAGCATAGTGCCTGG + Intronic
1095719965 12:45389818-45389840 AAGCTACTTAGAATAGTGCCTGG + Intronic
1095924834 12:47567986-47568008 AAAGTGCTTAAAATAGTGCCTGG - Intergenic
1096064728 12:48730547-48730569 AGCGTGCTTAGTACAGTGCCTGG - Intergenic
1096135842 12:49199906-49199928 AAAGTACTTAGAATAGTGCCTGG - Intronic
1096212553 12:49777688-49777710 AAAGTGCTTAGAACAGTGCCTGG + Intergenic
1096374981 12:51101488-51101510 AGGGTGCCCAGAATATGGTCAGG - Intronic
1096465045 12:51843767-51843789 AGGGGGCTTCAAATATGGCCTGG + Intergenic
1096810048 12:54163442-54163464 AAAGTGCTTAGATTAGTGCCAGG + Intergenic
1097700540 12:62815649-62815671 AAAGTGCTTAGAATAGTGCATGG - Intronic
1097811812 12:64027141-64027163 AAAGTGCTTAGAATAGTGTCTGG - Intronic
1097975062 12:65676699-65676721 TTAGTGCCTAGAATATTGCCTGG - Intergenic
1098057201 12:66520585-66520607 TGTGAGCTTAGAATACTGCCTGG - Intronic
1098394006 12:69999178-69999200 AAAGTGCTTAGAATATTGTCTGG - Intergenic
1098842807 12:75496681-75496703 AGGGTGCTTAGAATAGAGGAAGG + Exonic
1099234381 12:80065649-80065671 AAAGTGCTTAGAATAGTTCCTGG - Intergenic
1099384768 12:82000724-82000746 AATGTGCTTAGAAAAGTGCCTGG + Intergenic
1099780283 12:87185179-87185201 TAAGTGCCTAGAATATTGCCTGG - Intergenic
1099907995 12:88794629-88794651 AAAGTGTTTAGAATAGTGCCTGG - Intergenic
1100305824 12:93349315-93349337 AAAGTTCTTAGAATAGTGCCTGG + Intergenic
1101160452 12:101968869-101968891 AGAGTGCTTGGAACAGTGCCTGG - Intronic
1101247054 12:102893572-102893594 ACAGTGCTTAGAACAGTGCCTGG - Intronic
1101759950 12:107650297-107650319 AAGGTGCTTAGAACAGTGCCTGG + Intronic
1101993514 12:109507336-109507358 GGAGTGCTTAGAATGGTGCCTGG + Intronic
1102023971 12:109702889-109702911 AAAGTGCTTAGAATAGTGCCTGG - Intergenic
1102169824 12:110833866-110833888 AAGGTGCTTAGAACAATGCCTGG + Intergenic
1102422224 12:112812991-112813013 AAAGTGCTTAGAACAATGCCTGG - Intronic
1102544895 12:113647365-113647387 AAGGTGCTTAGAATAGTGTCTGG - Intergenic
1102708170 12:114900894-114900916 AAAGTACTTAGAATAGTGCCTGG + Intergenic
1103000825 12:117384237-117384259 AGGGTGCTTAGAACATTCACGGG - Intronic
1103152454 12:118652664-118652686 ATGGTGCTTAGAATCGTGCCTGG - Intergenic
1103721037 12:122975593-122975615 AGGGTGCTTAGGACAGGGCCGGG + Intronic
1104458674 12:128936096-128936118 ACGGTGCCTGGAATAGTGCCTGG + Intronic
1106383933 13:29266181-29266203 AAAGTGCTTAGAATATTGCCTGG - Intronic
1106542400 13:30701662-30701684 AGAGTGCTTATAACAGTGCCTGG + Intergenic
1106975411 13:35205758-35205780 TGGCTGCTTAGAATATTCCATGG + Intronic
1107398535 13:40044605-40044627 AAGGTGTTTAGAACTTTGCCTGG - Intergenic
1108243756 13:48494184-48494206 ACTGTGCTTAGAATAATCCCTGG + Intronic
1108641262 13:52384465-52384487 AAGGTCCTTAGAAAAATGCCTGG + Intronic
1109286391 13:60413546-60413568 AAAGTGCTTAGAATACTGCTTGG + Intronic
1110105754 13:71674121-71674143 CTGGTGTGTAGAATATTGCCTGG - Intronic
1110408488 13:75177424-75177446 AGAGTGCTTAGACTAATGCATGG + Intergenic
1110554050 13:76838645-76838667 ACAGTGCTTAGAACACTGCCAGG + Intergenic
1111041766 13:82757779-82757801 AGGTGGCTTAGAATGTTGTCAGG - Intergenic
1111782910 13:92752450-92752472 AGAGTGCTAAGAATATTTTCTGG + Intronic
1112708934 13:102104261-102104283 AAGGTGCTTAGCACAGTGCCTGG - Intronic
1114540309 14:23450682-23450704 AAAGTGCTCAGAATAGTGCCTGG + Intergenic
1114747119 14:25161081-25161103 ATGGTGCTTAAAATTTTGGCAGG - Intergenic
1115092342 14:29593147-29593169 TGAGTGTTTAGAATAGTGCCTGG + Intronic
1115330712 14:32194290-32194312 CTGGTGCCTAGAACATTGCCTGG + Intergenic
1115386481 14:32804088-32804110 AAAGTGCTTAGGATATTGCTTGG + Intronic
1116579946 14:46627478-46627500 AGAGTGCTAAGAATATAGGCTGG + Intergenic
1116855101 14:49945161-49945183 AAGGTGCTTAGCACACTGCCTGG + Intergenic
1116939990 14:50781765-50781787 AAAGTGCTTAGAATTGTGCCTGG + Intronic
1118437945 14:65788487-65788509 AGTGGGCTTAGAACAGTGCCTGG - Intergenic
1119094145 14:71813133-71813155 AAAGTGCTTAGAACAGTGCCTGG - Intergenic
1119204682 14:72785257-72785279 AAAGTGCTTAGAACAGTGCCTGG - Intronic
1119312897 14:73665043-73665065 AGAGTACTTAGAATTGTGCCTGG + Intronic
1119433845 14:74585382-74585404 AAAGTGCTTAGAACAGTGCCTGG - Intronic
1119444659 14:74653170-74653192 AAAGTGCTTAGAATAGGGCCTGG + Intergenic
1119624763 14:76163284-76163306 AAAGTGCTTAGTATATTACCTGG + Intronic
1119638602 14:76296830-76296852 AAAGTGCTTAGAACAGTGCCTGG + Intergenic
1119640060 14:76308163-76308185 AGGATGCTTAGAATAATGCCTGG - Intergenic
1119982084 14:79093265-79093287 AGGATGCTTAGAATCTAGCCAGG + Intronic
1120249467 14:82044983-82045005 AGGATTCTTAGAATATTTGCAGG - Intergenic
1120684800 14:87525912-87525934 ATATTGCTTAGAATAGTGCCTGG - Intergenic
1121379720 14:93452807-93452829 AAAGTGCTTAGAACAGTGCCTGG + Intronic
1121736441 14:96221198-96221220 AAAGTGCTTAGAACATTGCTTGG + Intronic
1121835167 14:97085761-97085783 AAGGTGCTTTGAAGAGTGCCTGG - Intergenic
1122219606 14:100228274-100228296 TGTGTGCTTAGAACAATGCCTGG + Intergenic
1122219735 14:100229716-100229738 AGGCTGCTCAGAATAGTGCAGGG + Intergenic
1122255401 14:100472469-100472491 AGGGTGCTTTGCAGAATGCCTGG + Intronic
1123161785 14:106286130-106286152 AGGGTGCCTAGCACAATGCCTGG - Intergenic
1123179770 14:106459071-106459093 AGGGTGCCTAGCACAATGCCTGG - Intergenic
1123959319 15:25379192-25379214 AAAGTGCTTAGAACATTGCCTGG + Intronic
1125481829 15:40086436-40086458 AAGGTGCTTAGAAGAATGCTTGG - Intergenic
1125537315 15:40449216-40449238 AGTGTGCTTAGGACCTTGCCAGG + Intronic
1125888797 15:43250277-43250299 AGAGTGCTTAGAATAGTGCCTGG - Intronic
1125909620 15:43424529-43424551 AAAGTGCTTAGAATAATGCCTGG + Intronic
1126054108 15:44713148-44713170 AGCGCGCTTAGTGTATTGCCAGG - Intronic
1127039749 15:54961688-54961710 ATGGTGCTTAGCACAGTGCCTGG + Intergenic
1127045349 15:55019530-55019552 AGAGTGCTTAGAATAGTTCCTGG - Intergenic
1127304282 15:57686949-57686971 ATGGTTCTTAGAATAGTGCTTGG + Intronic
1127471335 15:59293247-59293269 AAAGTGCTTAGAATGTTGCTTGG - Intronic
1128310671 15:66630181-66630203 AGGGTGCTCAGAATGGTGCCTGG + Intronic
1128319899 15:66685940-66685962 AAGGTGCTTAGAATGGTACCTGG - Intergenic
1128505922 15:68272636-68272658 AGGGCACTTAGAATTGTGCCTGG - Intergenic
1128701822 15:69810199-69810221 AGAGTGCTTAGAACAGTGGCTGG + Intergenic
1128835387 15:70805155-70805177 AAAGTGCTTAGAACAGTGCCTGG - Intergenic
1130132759 15:81158146-81158168 AGAGTGCTTAGAAGAGTGTCTGG + Intergenic
1130376581 15:83334570-83334592 AAGGTGCTTAGAAGAATGCCAGG - Intergenic
1130833763 15:87629562-87629584 AAGGTGCTTAGAATAGTGCTGGG - Intergenic
1131399299 15:92111721-92111743 AGGGTGCCTAGCATGATGCCTGG + Intronic
1131423077 15:92323520-92323542 AAAGTGCTTAGAACACTGCCAGG - Intergenic
1132209808 15:100011592-100011614 AAAGTGCTTAGAACATTGCCTGG - Intronic
1132267468 15:100487334-100487356 AAAGTGCTTAGAATAGTGCTTGG - Intronic
1133075944 16:3281466-3281488 AGGATGCTTAGAACAGTACCTGG - Intronic
1133094798 16:3436325-3436347 AAAGTGCTTAGCACATTGCCTGG + Exonic
1133448334 16:5881863-5881885 AATGTGCTTAGAAGAGTGCCTGG - Intergenic
1133547974 16:6826365-6826387 GGGGTGCTTAGAACACTGCCTGG + Intronic
1133709961 16:8391827-8391849 AAAGTGCTTAGCATACTGCCTGG - Intergenic
1133826040 16:9279070-9279092 AAAGTGCTTAGAATAGTGCCTGG - Intergenic
1134274501 16:12763537-12763559 AAAGTGCTTAGAATATTGGCTGG - Intronic
1134398866 16:13890245-13890267 CCTGTGCCTAGAATATTGCCTGG - Intergenic
1135080045 16:19426419-19426441 AGTGTGCTCAGAATCCTGCCAGG - Intronic
1135115590 16:19720524-19720546 AAGGTGCTTAGCACAGTGCCTGG + Intronic
1135247184 16:20867065-20867087 AAAGTGCTTAGCATAGTGCCTGG - Intronic
1135635155 16:24069438-24069460 AGAGTGCTTAAAACAGTGCCTGG + Intronic
1135765375 16:25173180-25173202 CTGGTGCTTAGAAAAGTGCCGGG - Intronic
1135945312 16:26859835-26859857 AAAGTGCTTAGCATAGTGCCTGG - Intergenic
1135961491 16:26998187-26998209 AAGGTGCTTAGCACAGTGCCTGG + Intergenic
1136460762 16:30408615-30408637 GAGGTGCTTAGAACAGTGCCTGG - Intronic
1136553788 16:30996472-30996494 AAAGTGCTTAGAACAGTGCCTGG + Intronic
1136638922 16:31545568-31545590 AGGGTGAAGAGAATATTGCCAGG - Intergenic
1137339702 16:47589319-47589341 AAAGTGCTTAGAATAGTGCTTGG + Intronic
1137430680 16:48415940-48415962 AAACTGCTTAGAATAGTGCCTGG + Intronic
1137508750 16:49079781-49079803 ACAGTGCTTAGAATTGTGCCAGG - Intergenic
1138066762 16:53949503-53949525 AGGGTTCTTAGAATGGAGCCAGG + Intronic
1138416637 16:56875376-56875398 AAAGTGCTTAGAATAGTGCCTGG + Intronic
1139083522 16:63556333-63556355 ACTTTGCTTAGAATAGTGCCTGG + Intergenic
1139446598 16:67002010-67002032 AAGGTGCTTAGAAGAATGCCTGG - Intronic
1139979107 16:70839171-70839193 ACAGTGCTTAGAACACTGCCTGG - Intronic
1140013017 16:71154931-71154953 CAAGTGCTTAGAATAATGCCTGG + Intronic
1140848482 16:78912290-78912312 AAGGTGCATAGCATAGTGCCTGG - Intronic
1141190499 16:81821245-81821267 TGAGTGATTAGAATAATGCCTGG + Intronic
1141205518 16:81930207-81930229 AATCTGCTTAGAATATTGCCTGG + Intronic
1141363738 16:83422819-83422841 AAGATGCTTAGAAAAGTGCCTGG + Intronic
1141720665 16:85753520-85753542 TGGGTGCTGAGAATCTTCCCTGG + Intergenic
1143332840 17:6150179-6150201 AAAGTGCTTAGCATAATGCCTGG + Intergenic
1143364780 17:6399642-6399664 CCGGTGCTTAGAATGGTGCCAGG - Intronic
1143634210 17:8155094-8155116 AAAGTGCTTAGCATAATGCCTGG - Intronic
1143696865 17:8627785-8627807 AAACTGCTTAGAATAGTGCCTGG - Intronic
1144296969 17:13885461-13885483 AAAATGCTTAGAATACTGCCTGG + Intergenic
1144313108 17:14032395-14032417 AAAGTGCTTAGAATACTGCCTGG + Intergenic
1145086500 17:19946534-19946556 AAAGTGCTTGGAATATTGTCTGG + Intronic
1145109503 17:20149875-20149897 AATGTACTTAGAATAGTGCCTGG + Intronic
1146129294 17:30257163-30257185 ACAGTGCTTAGAATAGTGCCTGG - Intronic
1146533658 17:33631598-33631620 AGGGTGCTTAGCATTATGCCTGG + Intronic
1146673001 17:34754848-34754870 AAAGTGCTTAGATTAGTGCCAGG - Intergenic
1146678570 17:34790966-34790988 AAAGTGTTTAGAATAGTGCCTGG - Intergenic
1146911483 17:36651149-36651171 ATGGTGCTTAGCAGAGTGCCTGG + Intergenic
1146965266 17:37022765-37022787 ATGGCTCTTAGAATAGTGCCAGG + Intronic
1147449771 17:40496750-40496772 AATGTGCTTAGAACAGTGCCTGG + Intronic
1148555294 17:48575435-48575457 AGGGTGCTTAAAATATACACTGG + Intronic
1149331308 17:55585148-55585170 ATGGTGCTTAGCACAGTGCCTGG + Intergenic
1149434554 17:56622053-56622075 AGGATGAATAGAATTTTGCCAGG - Intergenic
1149649311 17:58267090-58267112 ACAGTGCTTAGAATAGTGCCTGG + Intronic
1149726581 17:58900893-58900915 TGTGTGCTTAGAATAATGTCTGG - Intronic
1150144237 17:62754366-62754388 AGAGTGGTTAGAATTTGGCCGGG - Intronic
1150608267 17:66712872-66712894 AAGGTGCCTAGAACAGTGCCTGG + Intronic
1151081933 17:71339433-71339455 AGAGAGATTAGAATATTTCCCGG + Intergenic
1151344094 17:73491092-73491114 AGTGTGCTTAGGATATGGGCTGG + Intronic
1152108912 17:78346297-78346319 CAGGTGCTTAGAATAGTGCTTGG + Intergenic
1153926270 18:9838084-9838106 AAAGTGCTCAGAATAATGCCGGG - Intronic
1154060123 18:11052167-11052189 AGGGTACTTAGAATAGTACCTGG + Intronic
1155528346 18:26740515-26740537 AAGGTGCTTAGAATGTTGTCTGG + Intergenic
1156315989 18:35969190-35969212 AAGATGCTTAGAAAAGTGCCTGG + Intergenic
1156583514 18:38407000-38407022 AAAGTGCTTAGAAAAATGCCTGG + Intergenic
1157160930 18:45313706-45313728 AAAGTGCTTAGAACAGTGCCTGG + Intronic
1157638168 18:49183507-49183529 AGGGTGAATCGAAAATTGCCAGG - Intronic
1157759887 18:50253561-50253583 AAAGTGCTTAGAATAGTGTCTGG - Intronic
1157858559 18:51121882-51121904 AAAGTACTTAGAATAGTGCCTGG - Intergenic
1158057559 18:53299942-53299964 AGAGTGCTTAGACCATTGCCAGG + Intronic
1158132828 18:54171745-54171767 AAGGTGCTTAGCACAGTGCCAGG - Intronic
1158281416 18:55832543-55832565 AAAGTGCTTAGAACAATGCCTGG + Intergenic
1158512835 18:58106658-58106680 AGAGTGCTAAGAACAGTGCCTGG + Intronic
1158710031 18:59829345-59829367 AAGATGCTTAGAACAGTGCCTGG + Intergenic
1158758546 18:60355988-60356010 GAAGTGCTTAGAATAATGCCTGG - Intergenic
1158789511 18:60760785-60760807 AAAGTGCTAAGAATATTTCCAGG + Intergenic
1159014064 18:63087454-63087476 ACAGTGCTTAGAACAATGCCTGG - Intergenic
1159265790 18:66076662-66076684 AGCATGCTTATAATACTGCCTGG + Intergenic
1161549002 19:4900450-4900472 AAAGCGCTTAGAATAATGCCAGG - Intronic
1162563724 19:11433464-11433486 AAAGTGCTTAGAACAGTGCCTGG - Intronic
1165044050 19:33090278-33090300 AGGGTACTGTGAATGTTGCCTGG + Intronic
1165315051 19:35049668-35049690 GGGGTGCTTAGAATAGTGCCTGG - Intronic
1165924072 19:39316198-39316220 AGCATACTTAGAATAGTGCCAGG + Intergenic
1166006545 19:39911677-39911699 GGAGTGTTTAGAATAGTGCCTGG + Intronic
1166648162 19:44548281-44548303 AAGGAACTTAGAATAGTGCCTGG - Intergenic
1166656108 19:44613417-44613439 AAGGTGCTTGGAGTAGTGCCTGG - Intergenic
1166950344 19:46423166-46423188 AAAATGCTTAGAATAGTGCCTGG + Intergenic
1167660359 19:50792535-50792557 ACTGTGCTTACAATAGTGCCTGG + Intronic
1167736524 19:51297642-51297664 AATGTGCTTAGAACATGGCCTGG - Intergenic
926291808 2:11537376-11537398 AGGGTGCTTAGCATGGTACCTGG - Intronic
926591267 2:14742647-14742669 AAAGTGCTTAGAACAGTGCCTGG + Intergenic
926612485 2:14960441-14960463 AAGGTGTTTAGGATAATGCCTGG - Intergenic
926708664 2:15857195-15857217 AGGATGCATAGTAGATTGCCAGG + Intergenic
926971189 2:18469142-18469164 AGGGAACTTAGAAAATTCCCAGG + Intergenic
927322976 2:21770113-21770135 ATGGTGCCTAGCATAGTGCCCGG - Intergenic
927668950 2:25052807-25052829 AAAGTGCTTAGAATTCTGCCTGG - Intronic
928469205 2:31556916-31556938 AAAGTACTTAGAACATTGCCTGG - Intronic
929206815 2:39305492-39305514 AAAGTGCTTAGAATAATGCCTGG + Intronic
929611809 2:43276287-43276309 AGGGTGCTTTGGACATTGCAGGG + Intronic
929624956 2:43396972-43396994 AACATGCTTAGAATAGTGCCGGG - Intronic
929825831 2:45309127-45309149 AAAGTGCTTAGAACAGTGCCTGG + Intergenic
929830866 2:45345297-45345319 AAAGTGCTTAGAACAGTGCCTGG + Intergenic
930616454 2:53599410-53599432 GGGGAGCTTAAAATAATGCCTGG - Intronic
930851368 2:55964765-55964787 GATGTGCTTAGAATAGTGCCTGG + Intergenic
931112088 2:59122175-59122197 AGGATGCTTAGCATCTTCCCTGG - Intergenic
931797955 2:65729780-65729802 AAAGTGCTTAGAATAGTGCCTGG + Intergenic
931828393 2:66025425-66025447 ATTGTGCTTAGAACAATGCCTGG + Intergenic
932442708 2:71747928-71747950 AGCGTGCTTAGAAGAGTGCCAGG + Intergenic
932611931 2:73206294-73206316 AGGGTGCTTAGCACTGTGCCAGG - Intronic
933150982 2:78915023-78915045 AGAGTTCTTAGAATAGTACCTGG + Intergenic
933233890 2:79842773-79842795 AAAGTGCTTAGTATTTTGCCTGG + Intronic
934106490 2:88699732-88699754 AAAGTTCTTAGAATATTGTCAGG + Intronic
934525137 2:95047351-95047373 AAAGTGCTTAGGATAGTGCCTGG + Intronic
934741635 2:96728033-96728055 AAAGTGCTTAGAACAATGCCTGG + Intronic
935558087 2:104532373-104532395 AAGGTGCTTAGAAAATTGCCTGG + Intergenic
938698459 2:133855426-133855448 ACTGTGCTTAGAACAGTGCCTGG + Intergenic
938811864 2:134861430-134861452 TAGGTTCTTAGAATAGTGCCTGG - Intronic
939313646 2:140518264-140518286 AGGATGCTTAGGATGTTTCCTGG + Intronic
939884951 2:147671465-147671487 AGGGTGCTTGGAACACTGCCTGG - Intergenic
939931776 2:148243967-148243989 AGGGAACCTAGCATATTGCCTGG + Intronic
940051779 2:149472675-149472697 AAAGTGCTTAGCATAGTGCCTGG - Exonic
940162204 2:150725545-150725567 AGCCTGCTTAGAAAATTACCTGG - Intergenic
940707475 2:157123849-157123871 TAGGGGCTTAGAATAATGCCTGG - Intergenic
941312906 2:163956341-163956363 AACATGCTTAGAATAGTGCCTGG + Intergenic
941964004 2:171282717-171282739 AAAGTGCTTAAAATAGTGCCTGG + Intergenic
943083241 2:183281825-183281847 TGGGTGCCAAGAATAGTGCCAGG + Intergenic
944143652 2:196483287-196483309 ATGGAGCTTAGCATAATGCCTGG - Intronic
944564337 2:200972253-200972275 AAAGTGTTTAGAATAGTGCCTGG + Intergenic
944583370 2:201152446-201152468 AAAGGGCTTAGAATAATGCCTGG + Intronic
944634500 2:201661657-201661679 AAAGTGCTTAGAACAGTGCCTGG - Intronic
944711987 2:202342650-202342672 AGGATGGTTAGAATTTTGCCAGG + Intergenic
944834324 2:203563257-203563279 AGATTGCCTAGAATAGTGCCTGG + Intergenic
945468601 2:210200905-210200927 AAAGCGCTTGGAATATTGCCTGG - Intronic
945959142 2:216114139-216114161 AAAGTGCTTAGAATAGTGCTTGG + Intronic
946395245 2:219440818-219440840 AGAGTGCTTAGCACAATGCCTGG + Intronic
946419873 2:219558603-219558625 AGGGTTCTTAGGACAGTGCCTGG - Intronic
946837751 2:223789030-223789052 AGGGTGCTTAAAATGCTGACAGG - Intronic
947151909 2:227124008-227124030 ATGGTGTTTAGCATAGTGCCTGG + Intronic
947586433 2:231359705-231359727 AGTGTGCTTAGAATAAGGCCAGG - Intronic
947725921 2:232400591-232400613 AGGATGCATAGCAGATTGCCAGG + Intergenic
949024094 2:241757106-241757128 CAAGTGCTTAGAATAATGCCTGG - Intronic
1169254803 20:4088779-4088801 AGGGTCCTTAGTATAGAGCCTGG + Intergenic
1169725365 20:8723594-8723616 AAGGAGCTTAGAACAGTGCCTGG - Intronic
1169807206 20:9571639-9571661 AGTGTGCTTAGAACAGTCCCTGG - Intronic
1170443748 20:16404055-16404077 AAGGTGCTTAACATAGTGCCTGG + Intronic
1170780541 20:19421878-19421900 AGGCTGGTTAGAGTTTTGCCAGG + Intronic
1170825675 20:19792791-19792813 AGGGGGCTCAGCATAGTGCCTGG + Intergenic
1170838080 20:19902061-19902083 AAAGTGCTTAGAACAATGCCTGG - Intronic
1170855186 20:20046309-20046331 AAAGTACTTAGAATACTGCCTGG + Intronic
1171422770 20:25029909-25029931 AGAGTGCTTAGAACAGTGCCTGG + Intronic
1172038786 20:32029333-32029355 AAGGTGCTTAGAATGGTGCCTGG - Intronic
1172408809 20:34707758-34707780 AAGCTGCTTAGCATAGTGCCTGG + Intronic
1172438702 20:34949754-34949776 AAAGTGTTTAGAATAATGCCTGG + Intronic
1172810194 20:37641880-37641902 AAAGTGCTTAGAACAATGCCCGG + Intergenic
1172995196 20:39065181-39065203 AAAGTGCTTAGAACAGTGCCAGG + Intergenic
1173950836 20:46992123-46992145 ATGTTGCTTTGAATAGTGCCTGG - Intronic
1174206748 20:48846024-48846046 AATGTGCTTAGAACAATGCCTGG - Intergenic
1174389053 20:50206242-50206264 AAAGTGCTTAGAATACTGCCTGG + Intergenic
1174563783 20:51449850-51449872 AAAGTGCTTAGAATAAGGCCTGG + Intronic
1175316812 20:58054453-58054475 AAAGTGCTTAGACTATTACCTGG - Intergenic
1179664574 21:42901655-42901677 AGAGTGCTTAGAACAGTGCCTGG - Intronic
1181138040 22:20783084-20783106 AAGGTGCTGAGAAGAATGCCCGG + Intronic
1181155141 22:20915618-20915640 AAAGTGCTTAGAATAGTACCTGG - Intergenic
1181728239 22:24826438-24826460 AGGGGGCTTAGGACACTGCCTGG + Intronic
1182756209 22:32681708-32681730 TGAGTGCTTAGAACACTGCCTGG - Intronic
1182983612 22:34696154-34696176 AGGGAGCTTAGAACAATTCCTGG + Intergenic
1183020065 22:35019660-35019682 AAAGTGCTTATAATAGTGCCTGG - Intergenic
1184799748 22:46752295-46752317 AGGCTGCTTGGAATGGTGCCTGG - Intergenic
949350433 3:3120021-3120043 ATTGTGTTTAGAATAGTGCCAGG - Intronic
949454380 3:4223434-4223456 ATGGTGCTCAGAACAGTGCCTGG + Intronic
949688963 3:6612735-6612757 AATGAGCTTAGAATACTGCCTGG + Intergenic
950015389 3:9751329-9751351 AAAGTGCTTAGAATAATGCCAGG + Intronic
950290550 3:11780642-11780664 AAAGTGCTTAGAAGAGTGCCTGG + Intergenic
950584972 3:13885859-13885881 AAAGTGCTTAGCACATTGCCAGG + Intergenic
951262644 3:20529112-20529134 GAAGTGCTTAGAATATTGCTTGG + Intergenic
951509798 3:23487573-23487595 AAGGTGCCTAGAACAGTGCCTGG - Intronic
951541402 3:23785641-23785663 TGAGTGCCTAGAATGTTGCCTGG - Intergenic
951598569 3:24345613-24345635 AAAGTGCTTAGAAGAGTGCCTGG + Intronic
951691383 3:25400038-25400060 AATATGCTTAGAATAATGCCAGG + Intronic
951896811 3:27617313-27617335 AGAGTGCTTAGAACAATGTCTGG + Intergenic
952167532 3:30767036-30767058 AAAGTGCTTAGAATAGTGCCTGG - Intronic
952321534 3:32282395-32282417 AGGGTTATTTGAATATTGACTGG + Intronic
952406038 3:33006054-33006076 AGGCTGCATAGGATATTGACAGG + Intronic
952945103 3:38473726-38473748 AGAGTGGTTAGAACACTGCCTGG - Intronic
953486094 3:43298080-43298102 AAAGTGTTTAGAATAGTGCCTGG - Intronic
953691747 3:45125520-45125542 AAAGTGCTTAGAATGGTGCCAGG + Intronic
953985457 3:47439012-47439034 CAAGTGCTTAGAATAGTGCCTGG - Intronic
955218201 3:57002405-57002427 ATAGTGCTTAGAACAGTGCCTGG - Intronic
955218203 3:57002443-57002465 ATAGTGCTTAGAACAGTGCCTGG - Intronic
955693219 3:61610231-61610253 AATGTGCTTGGAATAGTGCCTGG + Intronic
955878696 3:63521438-63521460 AAAGTGCTTAGAACAGTGCCTGG - Intronic
956011913 3:64841060-64841082 AAAGTGCTTAGAACAGTGCCTGG - Intergenic
956568649 3:70669345-70669367 ACAGTGCTTAGAAAACTGCCTGG + Intergenic
956721566 3:72122524-72122546 AAGGTGCTTAAAACAGTGCCTGG + Intergenic
956870442 3:73411893-73411915 AGAGTGCATAGAATAGTGTCTGG - Intronic
957544650 3:81621980-81622002 AGGGTTCTTAGAAAAATGCAGGG - Intronic
957928965 3:86852712-86852734 AAAGTGCTTAGAAGAGTGCCTGG + Intergenic
958452032 3:94285079-94285101 AGAGTGCTCAGTATAGTGCCTGG - Intergenic
958888715 3:99758886-99758908 AGAGTGCTTAGAACAGTGCCTGG - Intronic
959108952 3:102098621-102098643 ATAGTGCTTAGAATAGGGCCTGG - Intergenic
959118942 3:102209972-102209994 AAAGTGCTTAGAACAGTGCCTGG + Intronic
959387172 3:105724792-105724814 AGAGTGCTTACAACAGTGCCTGG - Intronic
960193504 3:114736263-114736285 ATGTTGCTTAGCATGTTGCCTGG + Intronic
960461458 3:117940980-117941002 AAGATGCTTAGAAAAATGCCTGG + Intergenic
960794422 3:121470519-121470541 AGGGTATTTAGAATAGTGCATGG - Intronic
961799451 3:129434234-129434256 AAAGGGCTTAGAATAGTGCCTGG - Intronic
962362173 3:134751786-134751808 AAAGTGCTTAGAACAGTGCCTGG - Intronic
962854605 3:139332490-139332512 AGAGTGCTGAAAATAGTGCCTGG + Intronic
962908787 3:139828991-139829013 AAAGTGCTTAGAACAGTGCCTGG + Intergenic
962936549 3:140086493-140086515 AGGGTGCTTGGAATGGTGCCTGG + Intronic
963499175 3:146103276-146103298 ATGGTGAGTAGAATATTGTCTGG + Intronic
963785694 3:149532188-149532210 AAGGTGCTTAGAACAGTGCCAGG + Intronic
963838614 3:150081979-150082001 AAAGTGCTTAGAATATAGCCTGG + Intergenic
964441508 3:156716208-156716230 ACAGTGCTTAGAATAGTGTCTGG - Intergenic
964620802 3:158718364-158718386 AGGGTGCTTAGAACAGTACCAGG - Intronic
965245825 3:166266917-166266939 AAAGTGTTTAGAATATTGTCTGG - Intergenic
965386486 3:168052189-168052211 CAAGTGCTTAGAATACTGCCTGG + Intronic
966424508 3:179766644-179766666 AAAGTGCTTAGAACAGTGCCTGG - Intronic
966488177 3:180494913-180494935 TTGATGCTTAGAATATTGACTGG - Intergenic
966491883 3:180536970-180536992 AGGCTGCTAAGAATAATGCAGGG + Intergenic
967097897 3:186192788-186192810 AGAGTGCTTAGAGCAATGCCTGG + Intronic
967319151 3:188178394-188178416 ATGGTGCTTAGAGTAGTCCCTGG - Intronic
967783412 3:193464579-193464601 TTGATGCTGAGAATATTGCCTGG - Intronic
967832550 3:193932892-193932914 AGAGTGCTTAGAACTGTGCCTGG + Intergenic
967900183 3:194441955-194441977 AAAGTTCTTAGAATAATGCCTGG - Intronic
969040770 4:4294080-4294102 AAAGGGCTTAGAATAGTGCCTGG + Intronic
969647879 4:8443605-8443627 AAAGTGCTTAGAATAGTTCCTGG + Intronic
970143089 4:13003926-13003948 ATGGTGCTTAGAAAAGTGTCTGG + Intergenic
970192057 4:13526758-13526780 AGATGGCTTAGAATAATGCCTGG - Intergenic
970510303 4:16775512-16775534 AAAGTGCTTAGAACAGTGCCTGG + Intronic
970626335 4:17888142-17888164 CTGCTGCTTAGAATAGTGCCTGG + Intronic
970924622 4:21436742-21436764 AAGGTGATTAGAATATTGCCTGG + Intronic
970983875 4:22132442-22132464 AGAGTGCTTCGAATAGTGTCTGG - Intergenic
971134540 4:23854017-23854039 AAAGTGCTTAGAATACTGCCTGG + Intronic
971165886 4:24183221-24183243 AGGGTGCTTAGAGCAGTGTCTGG - Intergenic
971255049 4:25006664-25006686 AAAGTGCTTAGAATAGTGCCTGG - Intronic
971263772 4:25080199-25080221 TGAGTGCTTAGAATAGTGTCTGG - Intergenic
971458801 4:26872021-26872043 TGTGTGCTTAGAATAGAGCCTGG + Intronic
972089202 4:35258404-35258426 AGGGCTTTTAGAATAATGCCAGG + Intergenic
972312588 4:37894648-37894670 AAAGTGCTTAGAACAGTGCCTGG + Intronic
972548745 4:40107803-40107825 AAGGTACTTAGAATATTGTGTGG + Intronic
972911862 4:43826718-43826740 ATAGTGCTTAGAACATTGCTTGG + Intergenic
973755702 4:54071357-54071379 AAAGTGCTTAGAATAGTGCTTGG - Intronic
973995919 4:56458432-56458454 AAAGTGCTTAGAGCATTGCCTGG - Intronic
974108495 4:57499121-57499143 AAAGAGCTTAGCATATTGCCTGG + Intergenic
974192307 4:58521727-58521749 AGGGTGCTTAAAATGGTGCCTGG - Intergenic
974438361 4:61885532-61885554 AAAGTGTTCAGAATATTGCCGGG + Intronic
974927357 4:68316710-68316732 AAAGTGCTTAGAACAATGCCTGG - Intronic
975196801 4:71535129-71535151 AAAGTGCTTAGAAGATGGCCTGG - Intronic
975354752 4:73388583-73388605 ACAGTGCTTAGAATAGTGCTAGG - Intergenic
975498147 4:75057043-75057065 AGCATGCTTAGAATAGTACCTGG + Intergenic
976204120 4:82608498-82608520 AAAGTGCTTAGAATAGTACCTGG - Intergenic
976234966 4:82887662-82887684 AGAGTGGTTAGAACAGTGCCTGG + Intronic
976281561 4:83332040-83332062 AAGGTGCTTAGAACAGGGCCAGG + Intronic
976308539 4:83586135-83586157 AAGGTACTTAGAATATTGCGTGG + Intronic
976358578 4:84150245-84150267 AAAGTGCTTAGAAGATTGCCTGG - Intergenic
976541835 4:86286464-86286486 AAAGTGCTTAGAACAGTGCCTGG - Intronic
978911071 4:114064696-114064718 AGGGTGATTAGAGTAGAGCCAGG - Intergenic
979181363 4:117732211-117732233 AAAGTGCCTAGAATAATGCCAGG - Intergenic
979340311 4:119514788-119514810 AAAGTGCTTAGAACATTTCCTGG - Intronic
979614830 4:122731245-122731267 ATGCTCCTTAGAATAGTGCCTGG + Intergenic
979863150 4:125719738-125719760 AAATTGCTTAGAATAGTGCCTGG + Intergenic
980723000 4:136721253-136721275 AGGCTGGTTGGAATTTTGCCGGG - Intergenic
980976513 4:139616192-139616214 AAAGTGCTTAGAAGAGTGCCTGG + Intergenic
980988952 4:139721447-139721469 AATTTGCTTAGAATATTGACTGG - Intronic
981160531 4:141493220-141493242 AATGTTCTCAGAATATTGCCTGG - Intergenic
981506048 4:145500646-145500668 CTAGTGCTTAGAATAGTGCCTGG + Intronic
981612715 4:146612699-146612721 TGGGTGCTTAGATTAGTACCTGG + Intergenic
982460246 4:155661051-155661073 AAAGTGCTTAGAATAATGCCTGG + Intergenic
982776180 4:159443934-159443956 AAGGTGCTTAGCACAATGCCTGG - Intergenic
983520904 4:168707979-168708001 ACTGTGCTTAGGACATTGCCTGG - Intronic
983996255 4:174186233-174186255 AGGGTGATGAGAAGATGGCCAGG + Intergenic
984569799 4:181378250-181378272 ATAATGCTCAGAATATTGCCTGG - Intergenic
984632717 4:182077657-182077679 CAAGTGCTTAGAATAATGCCTGG - Intergenic
985009567 4:185568651-185568673 AGGGTGCTTATAAGAGTGCCTGG - Intergenic
985274057 4:188220151-188220173 AAAGTGCTTAGAACAGTGCCTGG + Intergenic
986208482 5:5648201-5648223 AGGGTACTCAGAACAGTGCCTGG + Intergenic
986846304 5:11759741-11759763 GAGGAGCTTAGAATAATGCCTGG - Intronic
986949218 5:13061214-13061236 AGTGTGCTCAAAATATTGCCTGG - Intergenic
987024467 5:13910378-13910400 AAAGTGCTTAGAACAGTGCCTGG + Intronic
987289105 5:16491104-16491126 AGAGTGCTTAACATAGTGCCTGG - Intronic
987734807 5:21826782-21826804 AACGTGCTTAGAAAAGTGCCTGG - Intronic
988315738 5:29624695-29624717 AATGTACTTAGTATATTGCCTGG + Intergenic
989080396 5:37613724-37613746 CAAGTGCTTAAAATATTGCCTGG - Intronic
990133361 5:52614586-52614608 AGAGTGCTTAGTAGAGTGCCAGG + Intergenic
990457797 5:56004989-56005011 AGGGTGTTCTGAATAATGCCAGG + Intergenic
991432270 5:66560490-66560512 AGAGTGCTTAGAACAGTGCCTGG + Intergenic
991442770 5:66668655-66668677 AAAGTGTTTAGAATATTGTCTGG + Intronic
991732417 5:69602675-69602697 AAAGTGCTTAGAATTGTGCCTGG + Intergenic
991808849 5:70457819-70457841 AAAGTGCTTAGAATTGTGCCTGG + Intergenic
991862537 5:71025177-71025199 AAAGTGCTTAGAATTGTGCCTGG - Intergenic
992546559 5:77819432-77819454 CTAGTGCTTAGAATAGTGCCTGG - Intronic
992578763 5:78149414-78149436 AAGGTACTTAGAATAGTGCCTGG + Intronic
992670380 5:79054546-79054568 GTGGGGCTTAGAATAGTGCCTGG - Intronic
992751479 5:79866838-79866860 AGAGTACTTAGAACAGTGCCTGG + Intergenic
993554040 5:89313457-89313479 AAAGAACTTAGAATATTGCCTGG + Intergenic
993628586 5:90256264-90256286 ATGGTGATTAGAGTATTGTCAGG + Intergenic
994146163 5:96397642-96397664 ATAGTGCTTAGCACATTGCCTGG + Intronic
994998580 5:107098029-107098051 AAAGTACTTAGAATAGTGCCTGG - Intergenic
996030261 5:118696932-118696954 AGAGTGCTGAGAACAGTGCCTGG - Intergenic
996096979 5:119409312-119409334 AGAGTGTTTAGCATACTGCCAGG - Intergenic
997151906 5:131505951-131505973 ACTGTGCTTAGAATAGTGCCTGG + Intronic
997330458 5:133056901-133056923 ATAGTGCTCAGAATAATGCCTGG + Intronic
997895306 5:137710761-137710783 AAAGTGCTTAGAACAGTGCCTGG - Intronic
998101278 5:139437312-139437334 AAAGTGCTTAGAAGAGTGCCTGG - Intronic
998779064 5:145636102-145636124 AAAGTGCTTAGAATAGTGCTAGG - Intronic
998823938 5:146082283-146082305 AGAGTGCTTTGAAGAGTGCCTGG + Intergenic
998940310 5:147274693-147274715 CATGTGCATAGAATATTGCCTGG - Intronic
999177903 5:149644737-149644759 AAGGTGCTTAGCACAATGCCTGG - Intergenic
999739428 5:154538800-154538822 AAGGTGCTTAGCACAGTGCCTGG - Intergenic
999931602 5:156439133-156439155 AAGGTCCTTGGAATAGTGCCTGG - Intronic
1000160544 5:158593254-158593276 CAGGTGCTTAGAACAGTGCCGGG - Intergenic
1000193500 5:158936474-158936496 AAAGTGCTTAGCACATTGCCTGG + Intronic
1001115797 5:168938410-168938432 AAAGTGCCTAGCATATTGCCTGG + Intronic
1001818303 5:174690028-174690050 AAAGTGCTTAGAAGAGTGCCTGG - Intergenic
1003028655 6:2580861-2580883 AATGTGCTTAGTATAGTGCCTGG + Intergenic
1003115358 6:3280345-3280367 AGGGTGCTGATGATATGGCCCGG - Intronic
1003574990 6:7284572-7284594 TAGCTGCTTAGAACATTGCCTGG - Exonic
1003822154 6:9910731-9910753 ACAGTGCCTAGAATATTACCTGG + Intronic
1004239892 6:13911431-13911453 AAAGTGCTTAGAATACTACCTGG - Intergenic
1004271005 6:14195345-14195367 AAAGTGCTTAGTATAGTGCCTGG + Intergenic
1004976488 6:20973167-20973189 AGAATGCTTAGAATAGTGTCTGG + Intronic
1005685962 6:28253113-28253135 AAAGTGCTTAGAACAGTGCCTGG + Intergenic
1006318701 6:33306148-33306170 AGGGTGCTTACAACACTGTCTGG + Intronic
1006445113 6:34075725-34075747 AAGGTGCTTAGAACAGTTCCTGG + Intronic
1006625646 6:35395924-35395946 AAGCAGCTTAGAATAATGCCTGG + Intronic
1007006169 6:38365155-38365177 AAGGTGCTTAGCGTAGTGCCTGG - Intronic
1008638481 6:53436478-53436500 AAAGTGCTTAGAGTAGTGCCTGG - Intergenic
1008703395 6:54128843-54128865 AAAGTGCCTAGAATAGTGCCTGG + Intronic
1010708744 6:79146616-79146638 AAGGCTCTTAGAATAGTGCCTGG + Intergenic
1010712331 6:79189626-79189648 AAAGTGCTTAGAACAGTGCCTGG - Intergenic
1011280884 6:85676390-85676412 AGAGTGCCTAGAATAGGGCCAGG - Intergenic
1011532823 6:88342762-88342784 AGAGTGCTTAGAACAATACCTGG + Intergenic
1013141991 6:107346551-107346573 CTGGTGCTTAGAATAGTGCCTGG + Intronic
1013759424 6:113499595-113499617 AAAGTGTTTAGAATAGTGCCTGG + Intergenic
1014629781 6:123774143-123774165 AGGGTGCTCACACTCTTGCCTGG + Intergenic
1014730550 6:125026387-125026409 AAAATGCTTAGAATAGTGCCTGG + Intronic
1015015858 6:128412244-128412266 AGATTGCTTAGAACATTGCCTGG - Intronic
1015158238 6:130122559-130122581 AGCTTGCTTAGAACAGTGCCTGG + Intronic
1015441788 6:133256467-133256489 AAGGTGCTTAGAACTGTGCCTGG - Intronic
1016134428 6:140521551-140521573 AAGGAGCTTAGAATAGTGCCTGG + Intergenic
1016604622 6:145906020-145906042 AGTATGCTTAGAAGATAGCCAGG - Intronic
1016809848 6:148249694-148249716 AAAGTGCTTAGAACAGTGCCTGG - Intergenic
1017444469 6:154494759-154494781 AGGGTGAATAGAATACTGACAGG - Intronic
1017999602 6:159567427-159567449 ATAGTGCTTAGAATAAAGCCTGG - Intergenic
1018327635 6:162690227-162690249 AGAGTGCTTAGAATAGTACTTGG - Intronic
1018832080 6:167451004-167451026 AGGGTGCTTTGAATGTCCCCTGG + Intergenic
1018953810 6:168394906-168394928 AGGGTGATTAGGATCTTGACCGG - Intergenic
1019798248 7:3068041-3068063 AGGGTGAGAAGATTATTGCCTGG + Intergenic
1020664912 7:11028385-11028407 AAAGTGCTTAGAATAGTGACTGG + Intronic
1021024787 7:15651530-15651552 TAGGTGCTTAGAATACAGCCTGG - Intronic
1021419907 7:20434633-20434655 AAGGTGCTTAGAATAATGCCTGG - Intergenic
1021946130 7:25729412-25729434 TTGGTGCTTAGACTACTGCCTGG + Intergenic
1022128874 7:27384399-27384421 AAAGTGCTTAGAATAGGGCCTGG - Intergenic
1022286988 7:28962757-28962779 AGAGTGCTTAGATCACTGCCTGG - Intergenic
1022331332 7:29382114-29382136 AAAGTGCTTAGAACAATGCCTGG + Intronic
1022734015 7:33059283-33059305 AAAGTGCTTAGAAAAGTGCCTGG - Intronic
1024755683 7:52527710-52527732 AGGGTACTTAGCATATAGCAGGG + Intergenic
1026121872 7:67544801-67544823 CAAGTGCTTAGAATAGTGCCTGG - Intergenic
1026254501 7:68698935-68698957 AGGGTGGCTAGAATATAGGCAGG + Intergenic
1027752735 7:82171588-82171610 AAAGTGCTTAGAACAGTGCCTGG + Intronic
1027870187 7:83696683-83696705 AGGGTACTTAAAACAGTGCCTGG - Intergenic
1028166382 7:87542290-87542312 AATTTGCTTAGAATAATGCCTGG - Intronic
1028351240 7:89852087-89852109 AAAGTGCTTGGAATAGTGCCTGG + Intergenic
1028725937 7:94088045-94088067 AGAGTGCTGAGAATTTTGCAGGG + Intergenic
1028727462 7:94103824-94103846 AGGTTGGTTAGAAAAGTGCCTGG + Intergenic
1029861750 7:103579958-103579980 AGGCTACATAGCATATTGCCTGG + Intronic
1029907038 7:104102702-104102724 AAAGTGCTTAGAATAGTGCATGG - Intergenic
1030427427 7:109397072-109397094 AGCCTGCTTACAACATTGCCTGG + Intergenic
1031045232 7:116879987-116880009 TGAGTGCTTAGAATGGTGCCTGG - Intronic
1031407048 7:121398201-121398223 AAAGTGCTTAGAAAAGTGCCTGG - Intergenic
1031494683 7:122431980-122432002 AAAATGCTTAGAATAGTGCCTGG + Intronic
1031610324 7:123818643-123818665 TCAGTGTTTAGAATATTGCCTGG + Intergenic
1032792721 7:135254225-135254247 AGGGAGTTCTGAATATTGCCTGG - Intronic
1032991539 7:137399953-137399975 AGTGTGCTTAAAACAGTGCCTGG + Intronic
1036707128 8:11054545-11054567 TGTGTGCTTATAACATTGCCAGG - Intronic
1037520216 8:19673891-19673913 TGGGTGCCTAGAATAGTGCCTGG - Intronic
1037666947 8:20977983-20978005 AAAGTACTTAGAATAGTGCCTGG - Intergenic
1037697226 8:21234435-21234457 ATAGTGCTTAGAGTAGTGCCTGG + Intergenic
1040895144 8:52359519-52359541 AAAGTGCTTAGAATAGTGCCTGG - Intronic
1041133074 8:54723202-54723224 AAGATGCTTAGAATAGTGTCTGG + Intergenic
1041406778 8:57508230-57508252 AAGCTGCTTAGAACAGTGCCTGG + Intergenic
1042113590 8:65407812-65407834 AAGGTGCTTAGCATAGTGTCTGG - Intergenic
1042186968 8:66146142-66146164 AAAGTGCTTATAATATTACCTGG - Intronic
1042844827 8:73159307-73159329 AATGTGCTTGGAATAGTGCCTGG - Intergenic
1043472493 8:80576916-80576938 AAATTGCTTAGAATAGTGCCTGG + Intergenic
1043771807 8:84211908-84211930 AATGTGCTTATAATATTGCTTGG - Intronic
1044157913 8:88873097-88873119 AGTGTGCTCAGAATGCTGCCAGG + Intergenic
1044580439 8:93820686-93820708 ACAGTGCTTAGAAAAGTGCCTGG + Intergenic
1044795271 8:95890834-95890856 AAGGTGCTTAGAACACTGCTTGG - Intergenic
1044906422 8:97008811-97008833 AAAGTGTTTAGCATATTGCCTGG + Intronic
1045005264 8:97911908-97911930 TGTGTACTTAGAATAGTGCCTGG - Intronic
1045008868 8:97940039-97940061 AGAGTGTTGAGAATAGTGCCTGG - Intronic
1045121189 8:99037065-99037087 AAGGTGCTTAGAATAGCGCCTGG + Intronic
1045261245 8:100576533-100576555 AAAGTGCTTAGAATACTGCCTGG + Intronic
1045571743 8:103374735-103374757 AATGTGCTTAGAACAATGCCTGG - Intronic
1045633970 8:104161290-104161312 AAGATGCTGAGAATATGGCCTGG + Intronic
1046977330 8:120295466-120295488 AAAGTGCTTAGGATAGTGCCTGG + Intronic
1047103545 8:121707739-121707761 AGAGTGCTTAGAATAGTACCTGG + Intergenic
1047274807 8:123397654-123397676 CCAGTGCTTAGAATAATGCCTGG - Intronic
1047334996 8:123927008-123927030 AAAGTGCTTAGAACAGTGCCTGG - Intronic
1047345168 8:124020794-124020816 ACAGTGGTTAGAATGTTGCCTGG + Intronic
1047471268 8:125175240-125175262 TTGGTGCTTAGCATAATGCCTGG + Intronic
1047984531 8:130219057-130219079 AAGGTGCTTAAAATAGTGTCTGG + Intronic
1048660225 8:136591346-136591368 AAAGTGCTTAGAACAGTGCCTGG + Intergenic
1049141052 8:140954503-140954525 AACGTGCTTAGAATACTGTCTGG - Intronic
1049185930 8:141253494-141253516 GGTGTGCTTAGAACAGTGCCTGG - Intronic
1049913061 9:288584-288606 AAAGTGCTTAGAAGACTGCCTGG - Intronic
1050345051 9:4677941-4677963 AAAGTGCTTTGAATAGTGCCTGG - Intergenic
1050347054 9:4700698-4700720 AAAGTGCTTAGAATAGTCCCTGG - Intronic
1050814611 9:9794338-9794360 AGGATGCTTAGATTTTTGCAAGG + Intronic
1052631323 9:31044243-31044265 CTGGTGCTTACCATATTGCCAGG - Intergenic
1052766680 9:32648621-32648643 AAAGTGCTTAGCATAGTGCCTGG + Intergenic
1052841310 9:33293267-33293289 AAAGTGCTTAGGATAGTGCCTGG + Intronic
1053321434 9:37102225-37102247 AATGTGTTTAGAATAGTGCCAGG + Intergenic
1055142525 9:72892157-72892179 AGTGCACTTAGAATAATGCCTGG + Intergenic
1055317715 9:75050655-75050677 AGGGAGCTTAGAATGGTGGCTGG + Intergenic
1055573341 9:77639297-77639319 AGAGCGTTTAGAATAGTGCCTGG - Intronic
1056538047 9:87548036-87548058 GAAGTGCTTAGAATAATGCCCGG - Intronic
1058120500 9:101133601-101133623 CAGGTGCTTAGTGTATTGCCTGG + Intronic
1058822711 9:108747366-108747388 AGAGTTCTTAGAATACTGCCTGG + Intergenic
1058959151 9:109976521-109976543 AGGGTGAGTAGAAGATTGCTAGG + Intronic
1059014481 9:110499974-110499996 AAAGTGCTTAGAATAATGCCTGG - Intronic
1059639843 9:116205723-116205745 AAAGGGCTTAGAATAATGCCTGG - Intronic
1060023644 9:120152796-120152818 GGAGTGCTCAGAATACTGCCTGG - Intergenic
1060473838 9:123970590-123970612 AGGGGGCTTAGGAAATTTCCAGG + Intergenic
1060628856 9:125138197-125138219 AAGGTGCCTAGGATAGTGCCTGG - Intronic
1185734569 X:2487055-2487077 AGGAGGCTTAGCATATTGCTTGG - Exonic
1185929671 X:4188321-4188343 GGGGACATTAGAATATTGCCTGG + Intergenic
1186759487 X:12708694-12708716 AGGGTGCTCTGAAAATAGCCAGG + Intronic
1187233120 X:17441371-17441393 AAGGTGCTTAGAATAATGCCTGG - Intronic
1187375244 X:18746953-18746975 AAGGTGCTTAGAACAGTGCCTGG + Intronic
1187426038 X:19178088-19178110 AGGGTCTTGAGAATAGTGCCCGG - Intergenic
1187941904 X:24390840-24390862 AGAGTGCTTAGAACAGTGCCTGG + Intergenic
1188254001 X:27936815-27936837 AGAGTACTTAGAAAAGTGCCTGG + Intergenic
1189735591 X:44066627-44066649 ACGATGCTTAGAATATTGCCTGG + Intergenic
1189829061 X:44951968-44951990 AAGTTGCTTAGAATAGTGCTTGG + Intronic
1190089362 X:47424264-47424286 ACAGTGCTTAGAATAATGCTAGG + Intergenic
1190394278 X:49964362-49964384 AAGGTGCGTAGAATAAAGCCTGG - Intronic
1190874156 X:54447952-54447974 AAAGTGCTTAGAATAGTTCCTGG + Intronic
1191816578 X:65252423-65252445 AAAATGCTTAGAATAGTGCCTGG - Intergenic
1192175583 X:68882972-68882994 AAAGTGCTTAGAATAATGCCTGG - Intergenic
1193046688 X:77061441-77061463 AGGGTGCATGGAATATTGCCTGG + Intergenic
1193376069 X:80763111-80763133 AATGTGCTTAGAATAGTGCCTGG - Intronic
1194403238 X:93462816-93462838 AAAGCTCTTAGAATATTGCCTGG + Intergenic
1195166892 X:102229030-102229052 AGAGTGCTTAAAAGAGTGCCTGG - Intergenic
1195191968 X:102458058-102458080 AGAGTGCTTAAAAGAGTGCCTGG + Intronic
1195438228 X:104870425-104870447 AAAGTGCTTAGTATAGTGCCTGG - Intronic
1195479781 X:105331038-105331060 AAAGTGTTTAGAATAGTGCCTGG + Intronic
1195615526 X:106909167-106909189 AGAGTGCTTAGAATAATGCCTGG - Intronic
1195631300 X:107058382-107058404 AAGGTGTTTTGAATAGTGCCTGG - Intergenic
1195715581 X:107815231-107815253 AAAGTGCTTAGAACAATGCCAGG + Intergenic
1195802543 X:108729986-108730008 CAGGTGCTTAGAACAGTGCCTGG - Intronic
1196107579 X:111912987-111913009 AATGTGCTTAGAATAGTGCCTGG - Intronic
1196709497 X:118747969-118747991 GAGGTACTTAGAATAGTGCCTGG + Intronic
1196764605 X:119231550-119231572 CTTGTGCTTAGAATAGTGCCTGG - Intergenic
1196934965 X:120720457-120720479 AAGATGCTTAGAACAGTGCCTGG + Intergenic
1197332858 X:125175819-125175841 AGAGTGCTTAGCACAGTGCCTGG + Intergenic
1197555145 X:127944006-127944028 CCAGTGCTTAGAATAGTGCCTGG - Intergenic
1197604539 X:128569617-128569639 AAGTTTCTTACAATATTGCCTGG + Intergenic
1198122229 X:133605591-133605613 AAAGTGCTTAGCACATTGCCTGG + Intronic
1198230023 X:134680179-134680201 GGGATGCTTAGAACAGTGCCTGG - Intronic
1198491189 X:137143317-137143339 AGGGTGCTTAGCACAGTGCCTGG + Intergenic
1198576534 X:138016285-138016307 AAAGTGCTTAGAATAATGTCTGG - Intergenic
1198590321 X:138173192-138173214 AAAGTGCTTAAAATAGTGCCTGG + Intergenic
1198610720 X:138396594-138396616 ATAGTGCTTAGAATCATGCCTGG - Intergenic
1199030824 X:142997293-142997315 AAAATGCTTAGAATATTGTCTGG - Intergenic
1199049847 X:143224262-143224284 AAGGGGCTTAGAATTTTTCCTGG + Intergenic
1199202500 X:145108781-145108803 AAAGTTCTTAGAATATTACCTGG + Intergenic
1199843077 X:151670611-151670633 ACAGTGCTTAGAAGAGTGCCTGG + Intronic
1200311087 X:155078045-155078067 ACGGTGTTTAGCATAGTGCCTGG - Intronic
1202178495 Y:22119373-22119395 ATGGTGATTGGAATATTGTCTGG + Intergenic
1202212866 Y:22467021-22467043 ATGGTGATTGGAATATTGTCTGG - Intergenic