ID: 911503530

View in Genome Browser
Species Human (GRCh38)
Location 1:98719217-98719239
Sequence TAGAATATTGCCTGGCCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911503524_911503530 19 Left 911503524 1:98719175-98719197 CCTAGCTCATAGTGCTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 911503530 1:98719217-98719239 TAGAATATTGCCTGGCCCATAGG No data
911503527_911503530 -8 Left 911503527 1:98719202-98719224 CCCATGTAGGGTGCTTAGAATAT 0: 1
1: 0
2: 0
3: 14
4: 111
Right 911503530 1:98719217-98719239 TAGAATATTGCCTGGCCCATAGG No data
911503528_911503530 -9 Left 911503528 1:98719203-98719225 CCATGTAGGGTGCTTAGAATATT 0: 1
1: 0
2: 0
3: 26
4: 169
Right 911503530 1:98719217-98719239 TAGAATATTGCCTGGCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911503530 Original CRISPR TAGAATATTGCCTGGCCCAT AGG Intronic
No off target data available for this crispr