ID: 911503531

View in Genome Browser
Species Human (GRCh38)
Location 1:98719221-98719243
Sequence ATATTGCCTGGCCCATAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911503527_911503531 -4 Left 911503527 1:98719202-98719224 CCCATGTAGGGTGCTTAGAATAT 0: 1
1: 0
2: 0
3: 14
4: 111
Right 911503531 1:98719221-98719243 ATATTGCCTGGCCCATAGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 291
911503524_911503531 23 Left 911503524 1:98719175-98719197 CCTAGCTCATAGTGCTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 911503531 1:98719221-98719243 ATATTGCCTGGCCCATAGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 291
911503528_911503531 -5 Left 911503528 1:98719203-98719225 CCATGTAGGGTGCTTAGAATATT 0: 1
1: 0
2: 0
3: 26
4: 169
Right 911503531 1:98719221-98719243 ATATTGCCTGGCCCATAGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911503531 Original CRISPR ATATTGCCTGGCCCATAGGA AGG Intronic
900929964 1:5730209-5730231 ATAGCACCTGGCACATAGGAGGG + Intergenic
902070172 1:13727714-13727736 ACATTGCCTGGCCTGTAGCAGGG + Intronic
902641468 1:17768933-17768955 ATAGTGTCAGGCACATAGGAGGG - Intronic
902685930 1:18077691-18077713 ATAGTGCCTGGCACAGAGCAGGG + Intergenic
902994848 1:20216345-20216367 ACAGTGCCTGGCACATAGGGAGG + Intergenic
903303646 1:22396872-22396894 ACAGTGCCTGGCACATAGCAGGG + Intergenic
903307202 1:22421280-22421302 ATGATGCCTGTCCCATTGGAAGG - Intergenic
903695881 1:25206604-25206626 AAATTGCCTTGCACATAGTAAGG - Intergenic
903825151 1:26139380-26139402 AAAGTGCCTGGCACATAGTAGGG - Intergenic
903926276 1:26833090-26833112 AAAGTGCCTGGCACATAGTAGGG - Intronic
904480222 1:30788648-30788670 ATCATGCCTGGCACACAGGAGGG + Intergenic
904699028 1:32347359-32347381 ACAGTGCCTGGCCCATAGGGGGG + Intergenic
905273628 1:36802948-36802970 ACAGTGCCTGGCACATAGTAGGG - Intronic
907442332 1:54486862-54486884 ATAATTCCTGGCACATAGTAAGG - Intergenic
908570329 1:65403163-65403185 GTAGTGCCTGGCACATAGTAAGG - Intronic
908743875 1:67356490-67356512 AAACTGCCAGGCCCATGGGATGG - Intronic
910958948 1:92740088-92740110 ATATTCCCTGGCTCTAAGGAAGG - Intronic
911256343 1:95637700-95637722 AAAATGCCTGGCACCTAGGAGGG - Intergenic
911503531 1:98719221-98719243 ATATTGCCTGGCCCATAGGAAGG + Intronic
911651133 1:100389529-100389551 AGATTTCCTGGCTCATTGGAGGG + Intronic
912367112 1:109143237-109143259 ATCATGCCTGGCCCATACAATGG + Intronic
912870743 1:113303015-113303037 TTATTGCCTAGCTCACAGGAGGG - Intergenic
915250737 1:154586489-154586511 ATAGTGCCTGGCGCATAGCAGGG - Intronic
916529498 1:165642627-165642649 ATGATGCCTGACACATAGGAAGG - Intronic
916583062 1:166125539-166125561 TCAATGCCTGACCCATAGGAAGG - Intronic
917309298 1:173661729-173661751 ATAGTGCCTGGCATAGAGGAAGG - Intronic
918028388 1:180777515-180777537 ACATTGCCTGGTACATAGGAGGG + Intronic
918081788 1:181213528-181213550 ACAGTGCCTGACACATAGGAGGG - Intergenic
918328060 1:183429054-183429076 ATACTGCCTGGCACATGGCAGGG - Intergenic
918514337 1:185345785-185345807 TTAGTGCCTGGCACATAAGAAGG + Intergenic
920592621 1:207235632-207235654 ATATTGCTTGGCTCATCGTAGGG + Intergenic
921639480 1:217535047-217535069 AAAATGCCTGGCACATAGTAAGG + Intronic
922851921 1:228739837-228739859 ATAGTGCCTGGCACATAGCAGGG + Intronic
923009323 1:230075588-230075610 GCAGTGCCTGGCACATAGGAGGG - Intronic
923401636 1:233620879-233620901 ACATTGCCTGGCACATATAAAGG - Intronic
923413651 1:233733901-233733923 GTATTGCCTGTCTCCTAGGACGG + Intergenic
924085295 1:240445232-240445254 ATGTTGCCTGGCATATAGTAGGG - Intronic
924216616 1:241828739-241828761 AAACTGCCTGGCCCATTAGAAGG + Intergenic
924698262 1:246422870-246422892 ACAGTGCCTGGCACATAGTAGGG - Intronic
1063371792 10:5526991-5527013 ATAGTGGCTGCCCCATAGGGAGG - Intergenic
1063560250 10:7119466-7119488 AAATTGCCAGGCCGATAGGGTGG + Intergenic
1066050497 10:31631263-31631285 ATATATCCTGGCACATAGGTGGG - Intergenic
1067569691 10:47362374-47362396 ATCTTACCAGGCCCACAGGATGG + Intergenic
1069593477 10:69656012-69656034 ACAGTGCCTGGCCCATAGTCAGG + Intergenic
1069765591 10:70855606-70855628 ATAGTGCCTGGCATATAGTAAGG + Intronic
1070728094 10:78805821-78805843 AAAGTGCCTGGCCCATGGTAAGG - Intergenic
1070764503 10:79048631-79048653 AAATGGCCTGCCCCAAAGGAGGG - Intergenic
1071216245 10:83405439-83405461 ATAGTGCCTGGTACAGAGGAGGG + Intergenic
1071456433 10:85854872-85854894 ATGGTGCCTGGCACATAGCAGGG - Intronic
1074448726 10:113541527-113541549 ATAATGCCTGGCCCAAATGTAGG - Intergenic
1075365072 10:121879513-121879535 ATAATGCCTGGCACATAGTAGGG + Intronic
1077018997 11:409241-409263 ATGATGCCTGTCTCATAGGAGGG + Intronic
1080601163 11:33821579-33821601 ATGTTGCTTGGTTCATAGGAAGG - Intergenic
1080602493 11:33833552-33833574 ATAGTGCCTGGCACATAGTAGGG + Intergenic
1081569937 11:44283917-44283939 ATATTCCCTGCTCCATGGGAGGG - Intronic
1081667205 11:44923523-44923545 CCAGGGCCTGGCCCATAGGAGGG + Intronic
1083666563 11:64278460-64278482 ACAGTGCCTGGCGCAGAGGAGGG - Intronic
1084908484 11:72368003-72368025 ATATTGCCTGGCATGTAGTAAGG + Intronic
1085044729 11:73346246-73346268 ACAGTGCCTGGCGCATAGGAGGG + Intronic
1085291872 11:75406547-75406569 ATATTGCTTGGCACATGGTAAGG + Intronic
1085518880 11:77126808-77126830 ATAGTGCCTGGTTCATAGCATGG + Intergenic
1085722475 11:78924621-78924643 ACAGTGCCTGGCACATAGCAGGG + Intronic
1085763093 11:79259143-79259165 ATATTGCTTGGCCAAAAGGAGGG + Intronic
1086415821 11:86588086-86588108 ACAATGCCTGGCACATAGTAAGG - Intronic
1086566798 11:88236467-88236489 ACAGTGCCTGGCACATAGTAAGG - Intergenic
1088090131 11:106028152-106028174 ATATTACCTGGCACCTAGGCTGG + Intergenic
1088378479 11:109167852-109167874 GTATTTTCTGGCCTATAGGAGGG - Intergenic
1091232553 11:133998186-133998208 GAACTGCCTGGCCCATAGCAGGG + Intergenic
1093137922 12:15474157-15474179 ACATAGCCTGGCCCAGATGAGGG + Intronic
1094106968 12:26823524-26823546 ATATTGCCCGGCACACAGAAAGG + Intronic
1095943800 12:47742336-47742358 ACAGTGCCTGGCACATAGTAGGG + Intronic
1096807873 12:54151367-54151389 CTACTACCTGGCCCAGAGGAAGG + Intergenic
1097044256 12:56175571-56175593 ATAGTGCCTGGCGCATTGTAGGG + Intronic
1098168529 12:67721914-67721936 ATAGTGCCTTGCACATAGTAGGG - Intergenic
1100707732 12:97219826-97219848 ATAATGCCTGGCACATGGTAGGG + Intergenic
1100738017 12:97559498-97559520 ATATTGCCTTGCCAAGGGGAGGG - Intergenic
1101100988 12:101392360-101392382 AAAGTGCCTGGCACATAGGGTGG - Intergenic
1101372626 12:104143188-104143210 ACAGTGCCTGGCACATAGTAGGG + Intergenic
1101852127 12:108411829-108411851 ACATTGCTTACCCCATAGGAAGG + Intergenic
1102452644 12:113053322-113053344 CCAGTGCCTGGCACATAGGAGGG + Intergenic
1102567744 12:113808088-113808110 ATAGTGCCTGGCCCAGAGTAAGG + Intergenic
1102569680 12:113819809-113819831 CATTTGCCTGGCCCAGAGGAGGG - Intronic
1102769885 12:115466410-115466432 ACAATGCCTGGCACATAGCAGGG - Intergenic
1103510519 12:121470483-121470505 TTATTGCCTGGGCCCTTGGAGGG - Intronic
1106677041 13:31971330-31971352 ATATTGTCTGGCACCTAGGCAGG + Intergenic
1107166810 13:37291916-37291938 ACATTGCCTGGCCCATAGTAAGG - Intergenic
1109643003 13:65216480-65216502 AGATTTCATGGTCCATAGGAAGG + Intergenic
1109801763 13:67388761-67388783 ATATTTCCTTGGCCATAGGCAGG - Intergenic
1110715206 13:78694732-78694754 ATAGTGCCTGACCCATTGTAGGG + Intergenic
1111881231 13:93959727-93959749 ATAGTGCCTGGCTCCTAAGAAGG - Intronic
1112159433 13:96852460-96852482 AAATTACCCGGCACATAGGAAGG - Intergenic
1114181568 14:20372526-20372548 ATACTGCCTGGCCCAGAGCTTGG + Intronic
1114419930 14:22573342-22573364 ACATTGGCTGGCACATAGAAGGG + Intronic
1115092119 14:29590337-29590359 ATAGTGCCTGGCACACAGTATGG + Intronic
1115093514 14:29607079-29607101 ATTGTGCCTGGCACATAGTATGG + Intronic
1118336143 14:64854931-64854953 ATGGAGCCTGGCCCATTGGAGGG - Intronic
1119060344 14:71467942-71467964 ACAATGCCTGGCACATAGTAAGG + Intronic
1119931355 14:78550677-78550699 ATCTTGCCTGGCCTAAAGGTTGG + Intronic
1121226921 14:92327914-92327936 ATACAGCCTGGCCCATAGAAAGG + Intronic
1121910686 14:97789763-97789785 TTCCTGCCTGTCCCATAGGATGG + Intergenic
1122725089 14:103745269-103745291 CTCTTGCCTGGCCCCCAGGAGGG - Intronic
1124371836 15:29108455-29108477 ACATAGCCTGCCCCATTGGACGG - Intronic
1127968005 15:63938364-63938386 ATAGTGCCTGGCACACAGCAAGG + Intronic
1128749215 15:70136851-70136873 ACATTGCCTTGCCAATAGTAAGG - Intergenic
1128838297 15:70829107-70829129 ACCATGCCTGGCCCATAGGCAGG + Intergenic
1129060241 15:72855255-72855277 ACAGTGCCTGGCACATAGAAGGG + Intergenic
1129500878 15:76036687-76036709 AAAATGCCTGGAACATAGGAAGG + Intronic
1129910988 15:79226165-79226187 AGTGTGCCTGGCCCATAGGAAGG + Intergenic
1131890100 15:96963461-96963483 ATTTTGCCTGGCATACAGGAGGG - Intergenic
1132162809 15:99558314-99558336 ATAGTGCCTGGCTCACAGCAGGG + Intergenic
1133466348 16:6030881-6030903 ACAGTGCCTGGCCCAGAGCATGG - Intronic
1133475291 16:6115484-6115506 ATATTGGCTGGCCCAAGGGGTGG + Intronic
1133719002 16:8476819-8476841 ACAGTGCCTGGCACAGAGGAGGG - Intergenic
1134804086 16:17110006-17110028 AAAGTGACTGGCACATAGGAGGG - Intronic
1135814750 16:25622411-25622433 CTATTGCCTGGCCCATACTAGGG + Intergenic
1135987107 16:27192042-27192064 ACAGTGCCTAGCACATAGGAGGG + Intergenic
1136453453 16:30367911-30367933 ATAGTGCCTGGCACACAAGAGGG + Intronic
1136649193 16:31651887-31651909 ATTGTGCCAGGCCCATAGCATGG - Intergenic
1137281340 16:46979347-46979369 ACAGTGCCTGCCACATAGGAGGG - Intergenic
1137579168 16:49622817-49622839 AAAGTGCCTGGCACATAGAAAGG + Intronic
1138444174 16:57053007-57053029 ACAATGCCTGGCCCACAGTAGGG - Intronic
1139059314 16:63229550-63229572 ATAATGCCTGGCACATATGTTGG + Intergenic
1139312899 16:66042217-66042239 AGATTTCCTGGCCCACAGGGAGG + Intergenic
1140986856 16:80166130-80166152 ATCTTGTCTGCCCCATGGGAGGG + Intergenic
1144048565 17:11476662-11476684 ATATTTCCTGGCCCAGAATATGG + Intronic
1144493895 17:15735379-15735401 ATATTGCCTTGCCCCTGGGCAGG - Exonic
1144906366 17:18641300-18641322 ATATTGCCTTGCCCCTGGGCAGG + Exonic
1145772150 17:27500996-27501018 ACAATGCCTGGTACATAGGAAGG - Intronic
1146009931 17:29185769-29185791 ATAGTGCCTGACCCATAGTTAGG - Intergenic
1146261522 17:31425245-31425267 ACAGTGCCTGGCACAAAGGAAGG + Intronic
1146951251 17:36908137-36908159 ACACTGCCTGGCACATAGTAGGG - Intergenic
1149434052 17:56618452-56618474 ATGGTGCCTGGCACATAGTAGGG - Intergenic
1151256406 17:72880159-72880181 ACACTGCCTGGCACATAGCAGGG + Intronic
1151331277 17:73410684-73410706 GTACTGCCTGGCCCAGAGAAAGG + Intronic
1153044211 18:840938-840960 ACAGTGCCTGGCACTTAGGAGGG - Intergenic
1155037307 18:22035612-22035634 ACAGTTCCTGGCCCATAGTAAGG - Intergenic
1156693525 18:39737381-39737403 ATATTGCCTGGCTCCTAGTGAGG + Intergenic
1156769768 18:40705629-40705651 ATAGTGCCTGGCACACAGTAAGG + Intergenic
1157499078 18:48177531-48177553 ATAATTCCTGGCCAACAGGAGGG + Intronic
1157566102 18:48680250-48680272 ATATGGTCTGGCCCAAAGTAGGG - Intronic
1158498194 18:57975524-57975546 ACAGTGCCTGGACCCTAGGAAGG + Intergenic
1162325699 19:9997875-9997897 ATGTTGCCTGGCCAAGTGGAGGG - Intronic
1162917637 19:13882836-13882858 ATATTCCCAGGCCCCTTGGAAGG + Exonic
1163769025 19:19179605-19179627 ACAGTGCCTGGCCAATAGGCAGG + Intronic
1164294394 19:23896803-23896825 ATATGGCCTGGGCCACAGGTGGG + Intergenic
1165789811 19:38484513-38484535 ATACTACCTAGCACATAGGAGGG - Intronic
1165908294 19:39207254-39207276 ACAGTGCCTGGCACATAGTAAGG + Intergenic
1166646210 19:44533462-44533484 ACAGTGCCTGGCACATAGTAGGG - Intergenic
1166909651 19:46143713-46143735 ATAGTGCCTGGCAAATGGGAAGG - Intronic
1168285150 19:55327865-55327887 GCATTGCATGGCACATAGGAAGG - Intronic
928212042 2:29330506-29330528 CCAGTGCCTGGCCCCTAGGAGGG + Intronic
932412709 2:71556643-71556665 AAAGTGCCTGGCCCTTGGGAAGG + Intronic
933907660 2:86911342-86911364 ATCATGCCTGGCCCACAGCAGGG - Intronic
933908908 2:86921057-86921079 ATCATGCCTGGCCCACAGCAGGG - Intronic
934023817 2:87982328-87982350 ATCATGCCTGGCCCACAGCAGGG + Intergenic
936364471 2:111840051-111840073 ATCATGCCTGGCCCACAGCAGGG + Intronic
937154016 2:119705705-119705727 ATATGGCCTGGCCAATGTGATGG - Intergenic
939636479 2:144589365-144589387 ATATCACCTGGCCCGTAAGAAGG - Intergenic
939977937 2:148741241-148741263 ATACTGCCTACCACATAGGATGG + Intronic
943169623 2:184380915-184380937 ATAATGCCTGGTACATAGGAAGG - Intergenic
943847816 2:192674331-192674353 TTATTGACTGGCCACTAGGACGG + Intergenic
944289032 2:197983566-197983588 ATAATATCTGGCCTATAGGAAGG + Intronic
944337679 2:198556457-198556479 CTATTGCCTGGCACATATTAAGG - Intronic
944531933 2:200675747-200675769 ACAGTTCCTGGCACATAGGAAGG - Intronic
946343691 2:219090405-219090427 ATAGTGCCTGGCACATAGGAAGG + Intronic
946857049 2:223961071-223961093 AGAGTGCCTGGCCCATAGTAAGG - Intronic
947010915 2:225565675-225565697 ATACTGCCTGGGATATAGGAAGG - Intronic
948634690 2:239327684-239327706 AGACTGCCTGGCTCACAGGATGG + Intronic
1168731914 20:91584-91606 ATAGTGCCTGTGCCATAGTAGGG + Intronic
1171903369 20:30878008-30878030 ATACTTCCTGGACCATTGGATGG - Intergenic
1172227562 20:33315250-33315272 ATGGTGCCTGGCACATAGTATGG + Intergenic
1173026973 20:39316739-39316761 AGAGTGCCTGGCCCATAGTTGGG + Intergenic
1173830969 20:46088230-46088252 ATATTGCAAGGCTCATTGGAAGG - Intronic
1174474981 20:50790260-50790282 ACAGTGCCTGGCACATAGTAAGG + Intergenic
1175676721 20:60952583-60952605 ATTTGGCCTTGCCCATATGATGG - Intergenic
1177806390 21:25879069-25879091 ATTTTGCCTGGCCCAAGGGGAGG - Intergenic
1179459617 21:41525065-41525087 AAAATGGCTGGCCCAAAGGAAGG + Intronic
1179528343 21:41999442-41999464 ATTTTGACTGACCCACAGGAAGG - Intronic
1179529949 21:42011174-42011196 ATAGTGCCCGGCTCATCGGAGGG + Intergenic
1179659966 21:42868126-42868148 ATCGTGCATGGCCCAGAGGAGGG - Intronic
1180336764 22:11583966-11583988 ATACTTCCTGGACCATTGGATGG - Intergenic
1180631051 22:17230175-17230197 ATAGTGCCAGGCTCAGAGGAAGG + Intergenic
1182228029 22:28815189-28815211 AGAGTGCCTGGCACACAGGAAGG + Intergenic
1182772960 22:32809091-32809113 ACAGTGCCTGGCACATAGTAAGG - Intronic
1182920512 22:34074986-34075008 ACACAGCCTGGCCCATAGTAAGG - Intergenic
1183573155 22:38669412-38669434 AGAGTGCCTGGCACATAGAAAGG - Intronic
1183855993 22:40635702-40635724 ACAGTGCTTGGCCCATAGTAAGG - Intronic
1185036891 22:48484071-48484093 CTAGTGCCTGGCCCTTAGTATGG + Intergenic
949385731 3:3500465-3500487 AAAATGCCTGGCCCATAGGGGGG - Intergenic
949815454 3:8053254-8053276 AGAATGCCTGGCACAGAGGAGGG + Intergenic
951109082 3:18780066-18780088 ATACTGCCTGACACATAGTAAGG + Intergenic
951650173 3:24942700-24942722 ATGTTGCCTGGCACATAATAAGG + Intergenic
953273751 3:41474037-41474059 ATATTGCCTTGGCCATTTGAGGG - Intronic
953945822 3:47146645-47146667 ATCATGCCTGGCCTATATGAAGG - Intronic
955401579 3:58595485-58595507 ATATTCCCTTGCCCTTAAGAAGG + Intronic
956016749 3:64891935-64891957 ATAATGTCTGGCACATAGTAAGG + Intergenic
956017937 3:64903970-64903992 ATAGTGCTTGGCTCTTAGGAAGG + Intergenic
956353476 3:68364742-68364764 ATTCTGCCTGGCACATATGAAGG - Intronic
957216845 3:77331287-77331309 ATATTGCCTGGTTCCTAAGATGG - Intronic
961154659 3:124669025-124669047 ATAGTGCCTGGCACAGAGCAAGG - Intronic
961585172 3:127915955-127915977 ATAGTGCCTGGCACTTAGAAGGG + Intronic
961998808 3:131273584-131273606 ATGTTGCCTGCCCCCTAGGAAGG + Intronic
962263688 3:133930788-133930810 ATGTTCACTGGCCCATGGGAGGG - Intergenic
962701454 3:138003743-138003765 ACAATGCCTGGCACATAGCAAGG - Intronic
962871526 3:139498092-139498114 AAATTGCATGGCCACTAGGAAGG + Intergenic
963796570 3:149636774-149636796 CTAATGCCTGGCCCAAAGCATGG - Intronic
964807077 3:160622076-160622098 ACATTGCCTGGCACATAGAAAGG + Intergenic
965204312 3:165701592-165701614 ATATTAGCTGGCTCAGAGGAGGG - Intergenic
965685764 3:171300757-171300779 ATCATGCCTGGCACAAAGGAAGG - Intronic
967536977 3:190616460-190616482 CCAGTGCCTGGCCCATAGGAGGG + Intronic
967996168 3:195168382-195168404 ATAGTGCTTGGCACATAGTAGGG - Intronic
968610062 4:1552805-1552827 AAACTGCCTGGCCCGAAGGAAGG + Intergenic
969484529 4:7464814-7464836 ATAGTGCCTAGCACAGAGGAGGG + Intronic
969927317 4:10597137-10597159 ATAGTGTCTGGCACATAGTAAGG + Intronic
970536757 4:17037933-17037955 ATAATGCCTAGCACATAGGAAGG - Intergenic
970652729 4:18196436-18196458 AGAATGCCTGGCCCATATTAAGG + Intergenic
971220167 4:24698341-24698363 TTATTGCCTGGGGCAAAGGATGG - Intergenic
972283163 4:37622764-37622786 AAACTGCCTGGCACATAGTAGGG + Intronic
972405148 4:38738463-38738485 AAATTGGGTGGCCTATAGGAAGG + Intergenic
972875836 4:43358761-43358783 ATACTGCTTGGCACATAGTAGGG - Intergenic
973154955 4:46939364-46939386 GTAGTGCCTGGCCCATATTAAGG - Intronic
973634097 4:52846012-52846034 GTATTGCCTGGCACATAGTAGGG + Intergenic
973634745 4:52851695-52851717 ACAGTGCCTGGCCTACAGGAAGG + Intergenic
976204119 4:82608486-82608508 ATAGTACCTGGCACATAGTAAGG - Intergenic
976227167 4:82804464-82804486 ACAGTGCCTGGCACATAGTAAGG + Intergenic
977859990 4:101945372-101945394 ATATTTCCTGGAACATAGCAAGG - Intronic
978533399 4:109736661-109736683 AGATTGCTTGGCACACAGGAGGG + Intergenic
979543863 4:121917467-121917489 ATACTGCCTGGATCATAGGAGGG - Intronic
979601805 4:122593635-122593657 GTAGTGCCTGGCACATAGTAAGG + Intergenic
979729524 4:124007443-124007465 ATAGTGCCTGGCATATAGTAAGG + Intergenic
982210894 4:153035154-153035176 AGAGTGCCTGGCCTATAGTAAGG - Intergenic
988685111 5:33518319-33518341 AGGTTGCCTGGCATATAGGAGGG + Intergenic
988863027 5:35304411-35304433 ATATTGCTTAGCCAAAAGGAAGG + Intergenic
990929592 5:61074107-61074129 ATAGTGCCTGGCACATTGTAAGG + Intronic
991455046 5:66793978-66794000 ATAGTGCCTGGCACATAGTAGGG + Intronic
991945068 5:71891767-71891789 ATAATGCCTGGCCCATAGCAGGG + Intergenic
991945287 5:71893403-71893425 ACATTGCCTGGCCCACAGTGAGG - Intergenic
992202320 5:74396509-74396531 AAATTACCTGGCACATAGTAAGG + Intergenic
992939281 5:81747476-81747498 ATAGTGACTGGCACACAGGATGG + Intronic
993318618 5:86443529-86443551 ATAATGTCTGGCACATAGTAAGG + Intergenic
995007571 5:107218685-107218707 ACAATGTCTGGCACATAGGAAGG - Intergenic
996768871 5:127064451-127064473 GTATAGCCGGGCCCATAGGTGGG - Intronic
997422547 5:133780604-133780626 ATACTGCCTGGAGCATAGCAGGG + Intergenic
998220102 5:140270634-140270656 ATCGTGCCTGGCCCATAGATTGG - Intronic
999280816 5:150364405-150364427 ATAATGCCTGGCACGGAGGAAGG - Intronic
999618285 5:153448836-153448858 ATAATGCCTGGCACATAGTTAGG + Intergenic
999767358 5:154751362-154751384 GTAGTGCCTGGCACATAGTAGGG + Intronic
1000280400 5:159776837-159776859 ACAATGCCTGGCACATAGGAAGG + Intergenic
1000507072 5:162134427-162134449 ACAATTCCTGGCACATAGGATGG - Intronic
1001084047 5:168687413-168687435 ACAGTGCCTGACCCAAAGGAAGG - Intronic
1001084093 5:168687865-168687887 ATATTACCTGGGCAAGAGGATGG + Intronic
1001876393 5:175205537-175205559 ATACTGTCTGGGTCATAGGACGG - Intergenic
1002523518 5:179803912-179803934 ATAGGGCCTGGCCCATGGGGAGG - Intronic
1002860231 6:1073669-1073691 ATATTCCATAGCCTATAGGAGGG + Intergenic
1003200878 6:3959291-3959313 ACAAAGCCTGGCCCATAGAAAGG - Intergenic
1005460425 6:26064321-26064343 ATAATGCCTGGTGCAGAGGAAGG - Intergenic
1006559529 6:34898068-34898090 ATAATGCCTGGCACATGGCAAGG + Intronic
1006819992 6:36885635-36885657 ATGCTGCCTGGCACATAGTAGGG + Intronic
1007342101 6:41197770-41197792 ATAGTGCCTGCCCCATAATAGGG + Intronic
1007671008 6:43553820-43553842 ACATTGCCTGGCCCATTAGTAGG + Intronic
1007764059 6:44150690-44150712 ACATTGCCAGCCCCATGGGAGGG + Intronic
1008159815 6:48063327-48063349 AGAGTGACTGGCTCATAGGAAGG - Intronic
1008299283 6:49814627-49814649 ATCTTCCCTGGCCCACAGAAAGG - Intergenic
1008847143 6:55981391-55981413 CTATTGCATTGCCCATGGGAAGG - Intergenic
1010734601 6:79429477-79429499 ACATAGCCTGGCACATAGAAGGG - Intergenic
1012437773 6:99233473-99233495 ATAATGCCTGGCACACAGGGGGG + Intergenic
1015738117 6:136423358-136423380 TCATTGCCTGGCCCACAGCAAGG + Intronic
1019035725 6:169056801-169056823 ATAGTGGCTGACCCATAGAATGG + Intergenic
1022184194 7:27951133-27951155 TCAGTGCCTGGCCCATAGTAAGG + Intronic
1024823168 7:53358197-53358219 ATAGTGACTGGACCATAGTAGGG - Intergenic
1026085701 7:67261275-67261297 ACAGTGCCTGGCATATAGGAAGG - Intergenic
1028764172 7:94531945-94531967 ATCTTGCCTGCCCCACAGGGTGG + Intronic
1029162980 7:98565986-98566008 ATAATGCCAGGTCCATAGCAGGG - Intergenic
1029410728 7:100408550-100408572 GTATTGCTTGGCCCAGATGATGG + Exonic
1031105972 7:117543489-117543511 CTAGTGCCTGGCACATAGTAAGG - Intronic
1032074166 7:128828530-128828552 AAATTGCCTGGTCCTTAGGTAGG - Intergenic
1032986133 7:137339536-137339558 ATGTTGCCTGACCCTTAGGCAGG + Intronic
1033545157 7:142392918-142392940 ACCTGGCCTTGCCCATAGGAGGG - Intergenic
1033906092 7:146204839-146204861 ACATTGCCTGTCCCATTGCATGG - Intronic
1034075099 7:148223980-148224002 ATATTGCCTGACCCATGCCAGGG + Intronic
1036053962 8:5229772-5229794 TTCTTGCCTGGCCCACAGGAAGG - Intergenic
1036519331 8:9475780-9475802 ATGGTGCCAGGCCCATAGTAAGG - Intergenic
1038346206 8:26734850-26734872 ACAATGCCTGGCACATAGCAAGG - Intergenic
1038398333 8:27263509-27263531 ACATTGCCTGGCACAAAGTATGG + Intergenic
1038839319 8:31166342-31166364 TTATTGGCTTGCCTATAGGAGGG + Intronic
1039627383 8:39068169-39068191 ATAGTCCCTGGTCCAAAGGAGGG + Intronic
1040780723 8:51106316-51106338 ACAATGCCTGACACATAGGAAGG - Intergenic
1042003577 8:64155135-64155157 ATATTGCCTGACCCATAGGTGGG - Intergenic
1042300533 8:67275646-67275668 ATAGTGTCTGGTGCATAGGAGGG - Intronic
1044472526 8:92586600-92586622 TTATTGCCTGGTCCAGGGGAAGG - Intergenic
1044969917 8:97609189-97609211 ATATTGCTTGACCTATAGAAGGG - Intergenic
1045272335 8:100672717-100672739 ACATGGCCTGGCTTATAGGAGGG - Intergenic
1046269368 8:111873511-111873533 ATAGTGCCTGTATCATAGGATGG - Intergenic
1047724557 8:127672571-127672593 ATAGTGCCTGGAACATAAGAAGG + Intergenic
1047744915 8:127837624-127837646 ATTTAGCCTGGCACACAGGAGGG - Intergenic
1048519606 8:135141438-135141460 ACATTAACTGGCCCATGGGAGGG + Intergenic
1048742834 8:137581010-137581032 ATAGTGCCTGGTCCATAGTAGGG + Intergenic
1051273810 9:15380040-15380062 ATATTCCCCGGCCCTTAAGAAGG - Intergenic
1051685362 9:19652872-19652894 ACAGTGCCTGGCACATAGCAGGG - Intronic
1051856113 9:21567226-21567248 ATAATGCCAGGCACATGGGAGGG - Intergenic
1053197538 9:36131509-36131531 ATCCTGCCTGGCCAATAAGAGGG + Intergenic
1053412196 9:37923039-37923061 ATAGAGCCTGGCCTACAGGAAGG - Intronic
1055102676 9:72481026-72481048 AGATTGCCTTGCGCATAGGGAGG - Intergenic
1055630910 9:78222324-78222346 TTACTGCCTGGCCCAGAAGAGGG + Intergenic
1055700980 9:78945679-78945701 ATATTGCCTGGAGAATAGCAAGG - Intergenic
1058564872 9:106272208-106272230 TTAGTGCCTGGCACATAGTAAGG - Intergenic
1059341076 9:113597897-113597919 ACAGTGCCTGGCACAGAGGAAGG - Intergenic
1059419954 9:114184648-114184670 ACAGTGCCTGGCACACAGGAAGG - Intronic
1059420437 9:114187173-114187195 ACAGGGCCTGGCCCAAAGGAAGG - Intronic
1059618683 9:115979154-115979176 ACAGTGCCTGGCACATAGCAAGG + Intergenic
1060673886 9:125494905-125494927 ACAGTGGCTGGCCCAGAGGAGGG + Intronic
1062008668 9:134255379-134255401 GTATTTCCTGGCCCTTAGCAAGG - Intergenic
1185929674 X:4188333-4188355 ATATTGCCTGGAACATGGTAGGG + Intergenic
1186892380 X:13971749-13971771 AGAATGCCTGGCCTATAGGAAGG - Intergenic
1187551023 X:20306201-20306223 ATAGTATCTGGCACATAGGAGGG - Intergenic
1188128189 X:26397687-26397709 GTTTTGCCTGGCACATAGCAGGG + Intergenic
1188671255 X:32884422-32884444 AAAGTGCCTGGCCCATAGTAAGG - Intronic
1195762954 X:108266730-108266752 ATATTGCCTGGCAAATGGTATGG + Intronic
1196287795 X:113902219-113902241 ACAGTGCCTGGCCCATAGACTGG + Intergenic
1196755407 X:119153342-119153364 ATAGTGCCTGTCCCTTAGGAAGG + Intergenic
1197332713 X:125173850-125173872 ATGTGGCCTTGCCCATAGCAGGG - Intergenic
1197638837 X:128946309-128946331 ATATTCCCTAGCCCCTAGGATGG + Intergenic
1198036222 X:132803881-132803903 ACAATGCCTGGAACATAGGAAGG + Intronic
1198492981 X:137162344-137162366 ATAATGCTTGGCACATAGTAGGG + Intergenic
1198677926 X:139150652-139150674 ACAGTGCCTGGCACATAGAAAGG - Intronic